Botanical Journal of the Linnean Society, 2009, 159, 237–244. With

Genetic diversity among genotypes of Eryngiumviviparum (Apiaceae): a plant threatened throughoutits natural range

M. CARMEN RODRIGUEZ-GACIO1, JUAN DE JESÚS1, MARÍA I. ROMERO2 andMARÍA T. HERRERA1*

1Department of Plant Physiology, University of Santiago de Compostela, 15782 Santiago deCompostela, Spain2Department of Botany, Faculty of Biology, University of Santiago de Compostela, 15782 Santiago deCompostela, Spain

Received 22 May 2006; accepted for publication 27 June 2008

Eryngium viviparum (Apiaceae) is an endangered aquatic plant, listed as threatened in several Europeandocuments. The genotypes are distributed patchily in various wetlands in the north-west of Spain and one islocated in north-west France. The study of the genetic diversity of a small population of a rare species is importantfor conservation and studies aimed at recovery programmes. Random amplified polymorphic DNA (RAPD) markerswere used to assess the genetic diversity among five Spanish and one French genotype. This technique hascontributed to the knowledge of the genetic diversity in E. viviparum, showing a greater genetic distance betweenthe Spanish cluster formed by S1, S4 than the second cluster formed by S2, S3, S5 and the French genotype.Mantel testing did not show a significant correlation between genetic and geographical distances, but a significantcorrelation was found between altitude, habitat and genetic distance. The French genotype showed the highestlevel of polymorphism (28.16) and the highest percentage of exclusive markers (32%). One of these was isolated,purified, cloned and sequenced, revealing a high homology to a protein mainly expressed in roots. This couldrepresent, for the F genotype, an adaptation to a specific habitat near the sea compared with the Spanish genotypeswhich grow inland. © 2009 The Linnean Society of London, Botanical Journal of the Linnean Society, 2009, 159,237–244.

ADDITIONAL KEYWORDS: conservation biology – endangered plant – habitat fragmentation – RAPD –Umbelliferae.

INTRODUCTION

Eryngium viviparum Gay (Apiaceae) is an endan-gered aquatic plant, growing in flat and depressedareas subjected to seasonal flooding for about 7–9months of the year. It is listed as a threatened plantin most European publications [see Annex I of theBerne Convention, 1979, and the Habitats Directive92/43/EEC (Annex II and IV)], and is considered as apriority species in the World Conservation Unionguide, where it has been classified as Vulnerable(Anonymous, 1983, 1997).

This species is an Atlantic region endemic, with adisjointed and fragmented distribution in the north-west of Spain and France (Brittany) (Fig. 1), and waspreviously present in north-west Portugal (Dupont,1962). At the present time, there is a single knownpopulation in France (Annezo, Lesouef & Riviere,1995) and the remaining examples (more than 93% ofE. viviparum of the world) are all located in north-west Spain (Romero & Rubinos, 2003; Romero, Ramil& Rubinos, 2004).

Human activities in the landscape, such as drain-age or transformation into agricultural systems, havean immediate and clear impact on populations, whichare either eliminated or fragmented into isolatedsmall-scale patches. All these events contribute*Corresponding author. E-mail: [email protected]

Botanical Journal of the Linnean Society, 2009, 159, 237–244. With 4 figures

© 2009 The Linnean Society of London, Botanical Journal of the Linnean Society, 2009, 159, 237–244 237

mailto:[email protected]

towards the loss of plant biodiversity (Heywood &Iriondo, 2003).

Biological conservation, assessing and maintaininggenetic diversity in both nature and germplasmbanks, is an important task in saving endangeredplants. In spite of the interest in the maintenance ofthe genetic resources in E. viviparum, its exact dis-tribution and the nature of its genetic variability areunknown.

Random amplified polymorphic DNA (RAPD)methods aid in this assessment, and are useful instudies of natural plant populations (Bussell, 1999;Nybom & Bartish, 2000). RAPD analysis has certainadvantages: it can potentially provide a large numberof reproducible marker loci and high levels of poly-morphism, costs much less, and is faster and easier toperform than microsatellite analysis, because no priorDNA sequence information for the target species is

required. In comparison with microsatellite analysis,there are some limitations and shortcomings ofRAPD, such as marker allele dominance (Lynch &Milligan, 1994) and sometimes low reproducibility,which may have discouraged many investigators fromusing RAPD. However, under carefully controlledreaction conditions, reproducible and interpretableRAPD banding patterns can be obtained (Sun &Wong, 2001; Jover et al., 2003). Potentially, this tech-nique is useful in the conservation context for rareand endangered species, such as E. viviparum,because only small quantities of biological materialare required (Rossetto, Weaver & Dixon, 1995;Cotrim, Chase & Pais, 2003).

The aim of this study was to examine the geneticvariations among six E. viviparum genotypes by theRAPD technique. The sample size was limited by theactual size of the natural populations. Similar prob-

0

50

42

38

46

54

4121 4 4 88

F

S1S4

S5S3

Figure 1. Location of the collected genotypes of Eryngium viviparum included in the study (see Table 1 for sampleabbreviations).

238 M. C. RODRIGUEZ-GACIO ET AL.

© 2009 The Linnean Society of London, Botanical Journal of the Linnean Society, 2009, 159, 237–244

lems with this size of sample were found by Sun &Wong (2001), Thomas, Sreejayan & Kuriachan (2001)and Ghany & Zaki (2003).

MATERIAL AND METHODSPLANT MATERIAL

Eryngium viviparum plants were obtained from sixgenotypes of this species: five were located in Spainand one in France. The Spanish samples were col-lected in the north-west of the Iberian Peninsula andone sample was obtained from the only French geno-type located in Brittany (Table 1). Each Spanish plantwas collected in the field and chosen at random fromthe small group of plants. The French sample wasobtained from a micropropagated plant, which wasderived from seeds supplied by the ConservatoireBotanique National de Brest (France).

In vitro cultures of the plants were prepared fromthe seeds and grown in Murashige and Skoog (MS)solid medium (Murashige & Skoog, 1962). Apical budsfrom plantlets were cultured on MS solid mediumsupplied with zeatin (23 mM) and naphthalene aceticacid (NAA) (0.54 mM).

DNA EXTRACTION AND AMPLIFICATION

Genomic DNA from both indoor and outdoor cultures(0.1 g from young, fresh leaves) was extracted usingthe method of Doyle & Doyle (1987) modified becauseof the small quantity of plant material available.Polymerase chain reactions (PCRs) (Table 1) wereperformed using a Techne Genius thermocycler.Primers for PCR amplification were obtained fromOperon Technologies and Amersham PharmaciaBiotech. Each RAPD reaction (50 mL final volume)contained 1.66 U of Taq polymerase (Bioline), 2 mM

MgCl2, 200 mM of each deoxynucleoside triphosphate(dNTP), 0.2 mM of primer, formamide 0.2% and 1 ng ofgenomic DNA. After initial heating for 2 min at 94 °C,

the samples were amplified using 35 cycles (94 °C,15 s; 34 °C, 2 min; 72 °C, 2 min), followed by a finalextension of the PCR products for 5 min at 72 °C.

FRAGMENT VISUALIZATION

Amplification products were resolved electrophoreti-cally on 1% agarose gels, run at 60 V for 210 min in1 ¥ Tris-acetate-EDTA (TAE) buffer, and visualized bystaining with ethidium bromide. Lambda DNAdigested with EcoRI and HindIII, ranging from 500 to21 000 bp, was used as a size marker.

Imaging gel bands were captured by a Versadocscanner (BioRad) and the sizes of all RAPD fragmentswere estimated using Quantity One Software(BioRad). Only those bands consistently reproducedin different analyses were considered. Each RAPDreaction was performed at least three times for eachprimer.

CLONING AND SEQUENCING OF PCR PRODUCTS

PCR products were excised from the agarose gels andpurified using a Gel Band Purification Kit (Amer-sham Pharmacia Biotech). The purified PCR productswere then cloned in pGEM-T Easy Vector (Promega)for subsequent transformation in Escherichia colistrain DH5a. Plasmid DNA was isolated usingQiaprep Spin Miniprep (Qiagen). The DNA wassequenced with an automated ABI PRISM 3100 DNASequencer (ABI). To minimize sequencing errors, atleast two independent clones of each amplified RAPDfragment were sequenced. The multiple DNAsequence alignment was carried out using CLUST-ALW (Thompson, Higgins & Gibson, 1994). Sequencesfrom the E. viviparum RAPD fragments were com-pared with the EBML plant database informationusing FASTA algorithms (Pearson & Lipman, 1988).

STATISTICAL ANALYSIS

Amplified fragments were scored in terms of the pres-ence (1) or absence (0) of homologous bands, and a

Table 1. Origin and location of plant materials collected for random amplified polymorphic DNA (RAPD) survey inEryngium viviparum

Country Province Site of collectionLatitude(N)

Longitude(W)

Altitude(m) Code

Spain (NW of Iberian Peninsula)Ayoó de Vidriales, Congosta 42°8′ 6°7′ 905 S1A Espiñeira, Lagoa de Cospeito 43°10′ 7°32′ 380 S2Melide 42°53′ 7°59′ 449 S3Otero de Bodas 41°56′ 6°11′ 810 S4S. Martín de Lamas, Veiga das Insuas 43°15′ 7°32′ 400 S5

France (Brittany)Brest 47°34′ 3°15′ 12–15 F

GENETIC DIVERSITY IN ERYNGIUM VIVIPARUM 239


matrix of the different RAPD phenotypes wasassembled. We assumed that each band showed thephenotype at a single biallelic locus and that RAPDmarkers represented dominant alleles (Williamset al., 1990). The pairwise distance matrix was com-puted based on Nei’s coefficient of similarity (Nei &Li, 1979) using NTSYS-PC 2.1 Software (numericaltaxonomy and multivariate analysis system) (Rohlf,2000), and a dendrogram was created with theunweighted pair group method with arithmetic aver-aging (UPGMA). The same presence/absence datamatrix was used to identify the unique markers ofE. viviparum which serve to characterize a specificgenotype.

In order to investigate the relationships amonggenetic and geographical distances and altitude andgenetic distance among genotypes of E. viviparum,Mantel (1967) tests were computed. All the analyseswere performed at least three times.

RESULTS

The results show the first attempt to use RAPDmarkers to characterize the genetic variations in E.

viviparum, an endangered and rare aquatic plantwhich survives in the north-western part of Spain andFrance. One or two small leaves were used for DNAextraction, thus minimizing the impact on the plants,and so RAPD is likely to be appropriate for the studyof populations with relatively small sample sizes(Rossetto et al., 1995; Prathepha, 2000).

RAPD ANALYSIS

One hundred and ten arbitrary primers werescreened and 16 (Table 2) showed a high level (up to65%) of polymorphism; these selected primers gener-ated 127 consistently well-amplified bands, ranging insize from 522 to 1799 bp, and 93 were polymorphic(73.22%) for the six genotypes.

Table 3 shows the percentage of polymorphic bandsobtained from a total of 742 bands in the six geno-types: 42.72% were polymorphic. Genotype F, corre-sponding to the French sample, showed the highestlevel of polymorphism (28.16%), and genotype S5,corresponding to one Spanish sample (Vega dasInsuas, see Table 1), showed the lowest percentage ofpolymorphic bands (12.53%).

Table 2. Primers and sequences of random decamers, base pair range scored, total bands, polymorphic bands andpercentage of polymorphisms for amplification profiles in Eryngium viviparum genotypes

Primer Sequence 5′ → 3′ Size (bp)Total numberof bands

Number ofpolymorphic bands

Polymorphicbands (%)

E-01 CCCAAGGTCC 550–2225 9 6 66.67E-12 TTATCGCCCC 770–2264 6 4 66.67E-15 ACGCACAACC 536–1781 9 6 66.67E-19 ACGGCGTATG 419–2387 13 11 84.62K-03 CAGAGGTCCC 523–1518 7 5 71.43K-14 ACGGGAGCAA 443–1525 8 7 87.50K-26 TGCGAGAGTC 412–1564 8 6 75.00K-30 ACGGATCCTG 448–2379 7 6 85.71L-13 ACCGCCTGCT 603–1298 6 4 66.67L-18 ACCACCCACC 541–2040 9 6 66.67M-02 ACAACGCCTC 643–1401 5 4 80.00M-03 GGGGGATGAG 393–1330 8 6 75.00M-07 CCGTGACTCA 595–1616 4 3 75.00M-16 GTAACCAGCC 545–2159 6 4 66.67P-08 ACATCGCCCA 558–2230 15 10 66.67P-19 GGGAAGGACA 373–1076 7 5 71.43Total 16 127 93Average 522–1799 73.27

Table 3. Average percentage of polymorphic bands obtained for the six genotypes of Eryngium viviparum

Sample S1 S2 S3 S4 S5 F

Polymorphic bands (%) 25.47 18.32 20.21 25.20 12.53 28.16



DIVERGENCE AT THE GENOTYPE LEVEL

The genetic distances among the six genotypes ofE. viviparum, estimated through RAPD analysis,showed different values for each sample. The greatestgenetic distance was obtained for the Spanish geno-types S1 and S5 (0.289) and the closest genetic dis-tance was obtained for S3 and S5 (0.173). The Frenchgenotype showed intermediate values.

The dendrogram generated from the genetic dis-tance matrix (Fig. 2) grouped all the genotypes intotwo clusters: the first cluster included S1 and S4with a genetic distance of 0.19; the second clustergrouped the French genotype with the Spanishsamples S2, S3 and S5, which constituted a sub-cluster inside the second cluster. These genotypesgrouped the former samples at 0.25. Thus, from theclustering of the genotypes, it was shown that theSpanish samples S2, S3, S5 showed less genetic dis-tance to the French sample than to the otherSpanish samples (S1, S4).

Mantel’s test was used to observe the relationshipbetween genetic and geographical distances by com-paring pairwise among E. viviparum; the resultsrevealed a nonsignificant correlation (P > 0.05)between RAPD and geographical distances (r = 0.233,P = 0.403). Similar results were obtained by Freitas &Brehm (2001). Mantel’s test was also useful for study-ing the relationship between genetic distance andaltitudinal habitats. The French genotype originatesfrom a low altitude, almost at sea level (12–15 m),whereas the genotypes S2, S3 and S5 as a group arefrom an intermediate average altitude of 409 m, andS1 and S4 are from a high average altitude of 857 m(Table 1). A comparison of these altitudinal habitats

and genetic distance revealed a significant correlation(P > 0.05) between them (r = 0.535, P = 0.018). Similarresults were found by Thomas et al. (2001). Altitudi-nal habitats permitted the classification of the geno-types into three groups, which were the same as thoseobtained from the dendrogram (Fig. 2).

Figure 2. Dendrogram of genetic distances among six Eryngium viviparum genotypes derived from random amplifiedpolymorphic DNA (RAPD) marker data.

982bp

Figure 3. Random amplified polymorphic DNA (RAPD)profile produced by Eryngium viviparum using the primerL-18. The molecular size marker is phage l, and S1, S2,S3, S4, S5 (Spanish) and F (French) correspond to thedifferent genotypes. The arrow indicates the size of theunique marker (bp) for sample F.



MOLECULAR ANALYSIS OF AN EXCLUSIVE MARKER

From the 110 primers tested, 67 unique markerswere detected for the six genotypes. Of these, theFrench sample showed the largest number (32%),with genotypes S1–S4 displaying values rangingbetween 9% and 26%; S5 did not show any specificmarker.

One of the unique markers from the French sample(Fig. 3) was 982 bp in size. This band was isolated,cloned and sequenced. The sequenced band was766 bp in size (Fig. 4). This was analysed with FASTAsoftware using EMBL plant database information,revealing that it produced high DNA sequence homol-ogy (94%) with the gene At1g80070.1 located on chro-mosome 1 of Arabidopsis thaliana (L.) Heynh. Thesoluble protein encoded by this gene in Arabidopsis isa splicing factor Prp8, related to a 278.12 kDa band,located mainly in the plastids and involved in themitotic cell cycle and cell cycle control. The expressionof the protein is observed in several parts of the plant,such as the leaves, seeds, siliques and seedlings, butthe protein is mainly expressed in the roots (16%)(data not shown).

DISCUSSION

This study provides the first characterization of themolecular genetic DNA diversity among genotypesof E. viviparum, an endangered aquatic plant, usingthe RAPD technique. RAPD was developed in thelast decade of the 20th century and has becomea successful tool. It has several applications, suchas the characterization of genetic resources inplants and the identification of species when mor-phologic characteristics are not discernible amongindividuals (Transue et al., 1994; Wolff & Morgan-Richards, 1998; Nebauer, del Castillo-Agudo &Segura, 2000).

RAPD represents an efficient technique for the gen-eration of molecular data with a small amount ofbiological material, which is very important in endan-gered and rare species, such as E. viviparum. It hasthe capacity to detect a high level of polymorphism.Thus, the average value of the polymorphic bandsfound was 73.27% (Table 2), similar to data obtainedby other authors, including Coletta-Filho et al. (1998)in mandarins (Citrus spp.), Irwin, Kaufusi & Banks(1998) in taro (Colocasia esculenta) and Bekessy et al.

TACCACCCACCTTASGTAGATTGTTGASCTTAATAGATCGTASTTGAAAGAGTGATATGG 60

TATTTCCAGAAGTAGCAACAATATTATTCTCCTCCCTGACAACCTCTTCCAACAAAGGAC 120

AATCGTCAACTATTAACTTTTCGAGTTGATGGASATTCTTAMAGACMGAACWMGARGACA 180

GAGCATRTACTCCGCARCTGTTAASTTCAACAACCTTTAACCTTTGGAAACTTAAACTTG 240

GGKAAGGATTTATTAAAAACTGCCCAACATTATGTATTCCGCAGATCCTGATGAGTCCAA 300

TCCCCTCCGAGATGATCCCTCTCGTATCGGCTGCCTGTCCNAGCTCCACGTCWCCTGAAA 360

TGGAATGCCACAGAGAGCCAGGTGGCCCTGGKAAACCTCGGSTGWKASGATGAGTAACAG 420

TAACANTGGTGGGAAGCTTTTTGTGAGAGAGAASACGGTGAGAANGGTATATCGYGASTG 480

YATGTGYGTGTGWGAATASYATGTGCGTAACCSTTTCCATCGGGGAANGGGGGCTTTNAT 540

AKKACCTGNKAGCGTGCTCGTACTCTTACCGNASAAMCGTGMGGTGATATGATGGGAAG 599

TAGTGGAACTTGGACAATTACCGCAGTCAGCACTTTCACATGTGCTGCTAYTAANAGCG 658

YACCGCMTCTGMNAGGTGGTCGTTACAGGNCGAATTCTSTMCCCGWGGCCANCGMNGNC 717

NGTACTTGNAMCACNGMRTCAGYGATTCTCGTYTWGGCWTTTGCRTGAC 766

Figure 4. DNA sequence of the unique marker obtained from primer L-18 in the French (F) sample. Nucleotidenomenclature: R = A or G; Y = C or T; K = G or T; M = A or C; S = G or C; W = A or T; N = any nucleotide.



(2002) in the monkey puzzle tree (Araucaria arau-cana). RAPD markers were also useful among variousspecies of Cicer for genetic fingerprinting purposes(Ahmad, 1999).

Using genetic distances, we were able to recon-struct a phylogenetic tree for the six genotypes;their genetic distances were in the range 0.219–0.25. The Spanish genotypes S1 and S4 showed alarger genetic distance from genotypes S2, S3 andS5 than from the French genotype. This could bebecause the former samples grow in an area sharedwith another species, E. galioides, and crossesbetween these two species cannot be discounted. Inthis respect, the position of S1 and S4 is interesting,because these genotypes showed the highest level ofspecific markers in the Spanish samples, with 18%for S1 and 26% for S4, and at the same timeshowed the highest percentage of polymorphic bands(Table 3). The French genotype has the greatestgenetic independence from the others, because ithas the greatest number of unique markers (32%)(data not shown); similar data were obtained byCotrim et al. (2003).

The French genotype also had a representativeexclusive marker which was isolated and sequenced.This band showed a high homology (94%) to the geneAt1g80070 of Arabidopsis thaliana which codes for aplastid protein involved in the control of the cellularcycle, expressed mainly in roots. This finding isimportant because of the different habitats of theFrench and Spanish genotypes. The former grows atsea level close to the seashore, which may mean anadaptation to a specific habitat located close to thesea for this population, whereas the Spanish geno-types are found at higher altitudes (400–900 m) withdifferent conditions.

In conclusion, our results indicate that RAPD isinformative and sufficiently powerful to assess thegenetic variability in E. viviparum. The genetic varia-tion reported provides a basis for the in situ conser-vation of genetic resources in this species. With aknowledge of the available genetic structure, anappropriate strategy for the sampling and propaga-tion of E. viviparum may be easily formulated whenex situ conservation is required.

ACKNOWLEDGEMENTS

We are grateful to Jean Yves Lesouef from the Con-servatoire Botanique National de Brest (France) forproviding seeds for the French population, and toPablo Ramil (University of Santiago de Compostela)and Patricio Bariego (Junta de Castilla y León, Con-sejeria de Medio Ambiente) who provided companion-ship and helped with the fieldwork.

REFERENCES

Ahmad F. 1999. Random amplified polymorphic DNA (RAPD)analysis reveals genetic relationships among the annualCicer species. Theoretical and Applied Genetics 98: 657–663.

Annezo N, Lesouef JY, Riviere G. 1995. Eryngium vivi-parum Gay. In: Olivier L, Galland J-P, Maurin H, eds.Livre rouge de la flore menacée de France. Paris: Institutd’Écologie et de Gestion de la Biodiversité/Muséum Nationald’Histoire Naturelle, 181.

Anonymous. 1983. Liste des plantes rares, menacées etendémiques en Europe. Strasbourg: Council of Europe.

.Anonymous. 1997. Red list of threatened plants. Gland/Cambridge: IUCN – The World Conservation Union.

Bekessy SA, Allnutt TR, Premoli AC, Lara A, Ennos RA,Burgman MA, Cortes M, Newton AC. 2002. Geneticvariation in the vulnerable and endemic monkey puzzletree, detected using RAPDs. Heredity 88: 243–249.

Bussell JD. 1999. The distribution of random amplified poly-morphic DNA (RAPD) diversity amongst populations ofIsotoma petrea (Lobeliaceae). Molecular Ecology 8: 775–789.

Coletta-Filho HD, Machado MA, Tragón ML, MoreiraMC, Pompeu J. 1998. Analysis of the genetic diversityamong mandarins (Citrus spp.) using RAPD markers.Euphytica 102: 133–139.

Cotrim HC, Chase MW, Pais MS. 2003. Silene rothmaleri P.Silva (Caryophyllaceae), a rare, fragmented but geneticallydiverse species. Biodiversity and Conservation 12: 1083–1098.

Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedurefor small quantities of fresh leaf tissue. Phytochemical Bul-letin 19: 11–15.

Dupont P. 1962. La flore Atlantique Européenne. Introduc-tion á l’étude du secteur Ibéro-Atlantique, Vol. 1. Toulouse:C.N.R.S. Faculté des Sciences, 414.

Freitas H, Brehm A. 2001. Genetic diversity of the Macaro-nesian leafy liverwort Porella canariensis inferred fromRAPD markers. The American Genetic Association 92: 339–345.

Ghany AA, Zaki EA. 2003. DNA sequences of RAPD frag-ments in the Egyptian cotton Gossypium barbadense.African Journal of Biotechnology 2: 129–132.

Heywood VH, Iriondo JM. 2003. Plant conservation, oldproblems, new perspectives. Biological Conservation 113:321–335.

Irwin SV, Kaufusi P, Banks K, de la Pena R, Cho JJ.1998. Molecular characterization of taro (Colocasia escu-lenta) using RAPD markers. Euphytica 99: 183–189.

Jover MA, del Castillo-Agudo L, Garcia-Carrascosa M,Segura J. 2003. Random amplified polymorphic DNAassessment of diversity in the western Mediterranean popu-lations of the seagrass Posidonia oceanica. AmericanJournal of Botany 90: 364–369.

Lynch M, Milligan BG. 1994. Analysis of population geneticstructure with RAPD markers. Molecular Ecology 3: 91–99.

Mantel NA. 1967. The detection of disease clustering and ageneralized regression approach. Cancer Research 27: 209–220.

Murashige T, Skoog F. 1962. A revised medium for rapid



growth and bioassays with tobacco tissue cultures. Physi-ologia Plantarum 15: 473–497.

Nebauer SG, del Castillo-Agudo L, Segura J. 2000. Anassessment of genetic relationships within the genusDigitalis based on PCR generated with RAPD markers.Theoretical and Applied Genetics 100: 1209–1216.

Nei M, Li W. 1979. Mathematical model for studying thegenetic variation in terms of restriction endonucleases. Pro-ceedings of the National Academy of Sciences of the UnitedStates of America 74: 5267–5273.

Nybom HI, Bartish V. 2000. Effects of life history traits andsampling strategies on genetic diversity estimates obtainedwith RAPD markers in plants. Perspectives in PlantEcology, Evolution and Systematics 3: 93–114.

Pearson WR, Lipman DJ. 1988. Improved tools for biologi-cal sequence analysis. Proceedings of the National Academyof Sciences of the United States of America 85: 2444–2448.

Prathepha P. 2000. Detection of RAPD variation in a foresttree species, Melientha suavis Pierre (Opiliaceae) from Thai-land. Science Asia 26: 213–218.

Rohlf FJ. 2000. NTSYS-PC. Numerical taxonomy system andmultivariate analysis system, v.2.1. New York: Exeter Soft-ware.

Romero MI, Ramil P, Rubinos M. 2004. Conservationstatus of Eryngium viviparum Gay. Acta Botanica Gallica151: 54–64.

Romero MI, Rubinos M. 2003. Eryngium viviparum Gay.In: Bañares A, Blanca G, Güemes J, Moreno JC, eds. Atlasy libro rojo de la flora vascular amenazada de España.

Taxones prioritarios. Madrid: Ministerio de MedioAmbiente–Tragsa, 694–695.

Rossetto M, Weaver PK, Dixon KW. 1995. Use of RAPDanalysis in devising conservation strategies for the rare andendangered Grevillea scapigera (Proteaceae). MolecularEcology 4: 321–329.

Sun M, Wong KC. 2001. Genetic structure of three orchidspecies with contrasting breeding systems using RAPD andallozyme markers. American Journal of Botany 88: 2180–2188.

Thomas G, Sreejayan JL, Kuriachan P. 2001. Geneticvariation and population structure in Oryza malam-puzhaensis Krish. et Chand. endemic to Western Ghats,South India. Journal of Genetics 80: 141–147.

Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTALW: improving the sensitivity of progressive multiplesequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. NucleicAcids Research 22: 4673–4680.

Transue DK, Fairbanks DJ, Robinson LR, AndersenWR. 1994. Plant genetic resources. Crop Science 34: 1385–1389.

Williams JGK, Kubelik AR, Livak KJ, Rafalski JA,Tingey SV. 1990. DNA polymorphisms amplified by arbi-trary primers are useful as genetic markers. Nucleic AcidsResearch 18: 6531–6535.

Wolff K, Morgan-Richards M. 1998. PCR markers distin-guish Plantago major subspecies. Theoretical and AppliedGenetics 96: 282–286.



Documents

Botanical Journal of the Linnean Society, 2009, 159, 237–244. With