Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
1
Title: Aspergillus fumigatus intrinsic fluconazole resistance is due to 1
the naturally occurring T301I substitution in Cyp51Ap. 2
Florencia Leonardelli 1,2, Daiana Macedo 1, Catiana Dudiuk 1,2, Matias S. 3
Cabeza 1,2, Soledad Gamarra 1, Guillermo Garcia-Effron # 1,2. 4
1 Laboratorio de Micología y Diagnóstico Molecular - Cátedra de 5
Parasitología y Micología – Facultad de Bioquímica y Ciencias Biológicas 6
– Universidad Nacional del Litoral. Santa Fe (Argentina). 7
2 Consejo Nacional de Investigaciones Científicas y Tecnológicas 8
(CONICET). CCT-Santa Fe (Argentina). 9
10
Key words: Aspergillus fumigatus, Fluconazole, Intrinsic Resistance 11
Mechanism, Azole resistance. 12
13
# Corresponding author: Dr. Guillermo Garcia-Effron. Laboratorio de 14
Micología y Diagnóstico Molecular (CONICET) – Cátedra de Parasitología y 15
Micología – Facultad de Bioquímica y Ciencias Biológicas – Universidad 16
Nacional del Litoral - Ciudad Universitaria – Paraje el Pozo S/N – Santa 17
Fe (Santa Fe) – CP 3000 – Argentina. 18
e-mail: [email protected] Phone: +54-342-4575209 int. 135. Fax: +54-19
342-4575216. 20
21
Running title: Fluconazole resistance mechanism in A. fumigatus. 22
23
AAC Accepted Manuscript Posted Online 5 July 2016Antimicrob. Agents Chemother. doi:10.1128/AAC.00905-16Copyright © 2016, American Society for Microbiology. All Rights Reserved.
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
2
Abstract 24
Aspergillus fumigatus intrinsic fluconazole-resistance has been 25
demonstrated to be linked to the CYP51A gene, although the precise 26
molecular mechanism has not been elucidated yet. Comparisons between A. 27
fumigatus Cyp51Ap and Candida albicans Erg11p sequences showed 28
differences in amino acid residues already associated with fluconazole 29
resistance in C. albicans. The aim of this study was to analyze the role 30
of the natural polymorphism I301 in the Aspergillus fumigatus Cyp51Ap in 31
the intrinsic fluconazole resistance phenotype of this pathogen. The 32
I301 residue at the A. fumigatus Cyp51Ap was replaced with a threonine 33
(analogue to T315 at Candida albicans fluconazole-susceptible Erg11p) by 34
changing one single nucleotide in CYP51A gene. Also a CYP51A knock out 35
strain was obtained using the same parental strain. Both mutant’s 36
antifungal susceptibilities were tested. The I301T mutant exhibited a 37
lower level of resistance to fluconazole (MIC 20 µg/ml) than the 38
parental strain (MIC 640 µg/ml) while no changes in MIC values were 39
observed for other azole and non-azole based drugs. This data strongly 40
implicate the A. fumigatus Cyp51Ap I301 residue in the intrinsic 41
resistance to fluconazole. 42
43
44
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
3
Introduction 45
Aspergillus fumigatus is the most common hyphomycete to cause disease in 46
humans (1-3). It is intrinsically resistant to ketoconazole and 47
fluconazole but normally susceptible to the other available azole 48
antifungal agents (itraconazole, posaconazole, voriconazole and 49
isavuconazole) (4-8). The molecular mechanism for fluconazole intrinsic 50
resistance has not been described yet. However, a hypothetical molecular 51
mechanism has been proposed by Edlind et al. who linked A. fumigatus 52
fluconazole intrinsic resistance with a naturally occurring amino acid 53
substitution in Cyp51Ap (14-α sterol demethylase A) (9). These authors 54
carried out an in silico comparison of the Candida albicans Erg11p and 55
A. fumigatus Cyp51Ap sequences and found that among the residues most 56
commonly implicated in fluconazole-resistance in C. albicans (Y132, 57
T315, S405, G464 and R467) (10,11), only the T315 residue is not 58
conserved in A. fumigatus Cyp51Ap and is naturally replace by a non-59
polar isoleucine (I301). In C. albicans, the substitution of the polar 60
T315 residue by the non-polar alanine (T315A) is enough to confer 61
fluconazole resistance to the yeast (10). 62
The aim of this study was to molecularly confirm that the natural 63
polymorphism I301 in the Cyp51Ap is necessary and sufficient to explain 64
the fluconazole intrinsic reduced susceptibility of A. fumigatus. An A. 65
fumigatus mutant harboring the I301T substitution was generated and 66
susceptibilities to fluconazole and other antifungals were tested. Also 67
a CYP51A-defective mutant was obtained using the same parental strain in 68
order to compare their antifungal susceptibility patterns. 69
70
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
4
71
MATERIALS AND METHODS 72
Strains. Aspergillus fumigatus akuBKU80 (12) was considered the wild-type 73
strain and its DNA was used as template for all the PCRs. It was the 74
recipient strain for electroporation assays. Escherichia coli TOP10 75
(Promega) was used to propagate all plasmids. 76
77
Genetic constructs. A transformation plasmid named LMDM-P87 was 78
generated. It contains a mutated T973C CYP51A gene (that leads to the 79
amino acid substitution I301T in Cyp51Ap) with its intact 5’ flanking 80
region. The CYP51A 3’UTR region is interrupted by a hygromycin B 81
resistance cassette (hph) between nucleotides 126 and 127 upstream the 82
CYP51A stop codon. Plasmid LMDM-P87 was obtained in two sets of three 83
PCR reactions each (Figure 1). The first set was aimed to introduce the 84
mutation T973C to the CYP51A. In the first reaction of this set, primers 85
A7 and A19 were used to amplify a 1452 bp fragment which contained a 462 86
bp of the CYP51A promotor region plus 990 bp of the first portion of its 87
coding sequence (5´ UTR region and 5’ of the ORF). The second PCR 88
employed the oligonucleotides A18 and A17, which amplify a 790 bp 89
fragment including 664 bp of the 3’ portion of the CYP51A ORF and 126 bp 90
upstream of the CYP51A stop codon (3’UTR region). The primer A18 carries 91
the mutation T973C in the middle of its sequence. The primer A19 is 92
reverse complementary with A18 and both generate an overlapping region 93
of 35 bp which was used in the following fusion-PCR. The final reaction 94
was performed using the primers A7-A17 and the two previously generated 95
fragments (1452 bp and 790 bp) as templates. The resulting 2.2 kb 96
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
5
product was cloned into the pGEM-T Easy Vector (Promega) to obtain the 97
plasmid LMDM-P75. Both strands of the complete 2.2 kb construct were 98
sequenced to confirm the presence of the mutation, as described 99
previously (13). In parallel a second set of PCR reactions was 100
performed. The hph cassette was fused to a 0.9 Kb fragment of the 3’UTR 101
region of CYP51A starting 127 bp upstream the CYP51A stop codon. The 102
resistance cassette was used as selection marker for recombinants while 103
the 0.9 Kb fragment was used later as flanking region for homologous 104
integration together with the 5’UTR-CYP51A In the first PCR 105
amplification of this set, the 1.4 kb hph cassette was obtained from the 106
plasmid pUM102 (A. fumigatus CYP51AΔhph) (a kind gift of Dr. Emilia 107
Mellado) (14) using the primers H1 and HF2. The second PCR was performed 108
using the primers HF1 and H2 in order to obtain the 0.9 kb fragment of 109
the 3’UTR region of CYP51A gene described before. HF1 and HF2 are 110
reverse complementary primers designed to allow the fusion of the 111
described fragments in the next reaction. The last PCR of this set was 112
done using the 1.4 kb (hph) and the 0.9 kb fragments as templates and 113
the primers H1 and H2. These last oligonucleotides include a SacI site 114
on both ends. The resulting construct (2.3 kb) was cloned into a pGEM-T 115
Easy Vector to obtain the plasmid LMDM-P82. 116
To generate the complete transformation vector, the 2.3 kb fragment with 117
hph cassette was released from the LMDM-P82 by SacI digestion following 118
manufacturer’s instructions (Promega). Simultaneously, LMDM-P75 was 119
linearized with SacI and dephosphorylated using Calf Intestinal Alkaline 120
Phosphatase (CIAP, Promega) according to the manufacturer’s protocol. 121
Afterwards, the 2.3 kb fragment was ligated with T4-DNA ligase (Promega) 122
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
6
to the linearized LMDM-P75 to create LMDM-P87. The complete vector 123
sketch can be seen in figure 1. Primer sequences are described in table 124
1. 125
126
Transformations. Two linear PCR fragments were used for A. fumigatus 127
akuBKU80 transformation: (i) the cassette containing the mutated CYP51A 128
gene together with the hph selection marker (LMDM-P87) and (ii) the 129
CYP51A knock out cassette (14). Fragments were PCR-amplified with the 130
primer pairs A7/H2 and P450.1/P450.2, respectively. Transformation 131
experiments by electroporation were carried out as described before 132
(13)using 0.3 µg of the PCR fragments. Transformants were selected with 133
350 µg/ml of hygromycin B (HygB) (InvivoGen) in minimum medium (MM) (15) 134
and subcultured for further analysis. The incorporation of the hph 135
cassette was phenotypically confirmed by plating the strains in 136
duplicate in MM with 350 µg/ml HygB. 137
138
Integration confirmation. Genomic DNA from HygB-resistant transformants 139
and the parental strain were obtained (14). Two multiplex-PCR reactions 140
were performed to confirm the homologous recombination of the mutated 141
CYP51A/hph cassette and the knock-out cassette (Figure 2A). The first 142
multiplex reaction was performed with two primer pairs and it was aimed 143
to verify the integration of the hph cassette in the A. fumigatus 144
genome. Primers A7 and A10 were used as PCR reaction control as they 145
hybridize the 5´UTR and the ORF of the CYP51A, respectively. Primers HS3 146
and HS4 were used to amplify a fragment of the hph cassette. Thus, two 147
PCR fragments were expected when the hph cassette was integrated (1066 148
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
7
bp and 386 bp). Contrariwise, only the 1066 bp fragment would be 149
amplified in non-transformant strains. The second multiplex PCR reaction 150
was meant to confirm the homologous recombination of the mutated CYP51A, 151
using the primers A14, HS3 and HS4. Primer A14 was designed to hybridize 152
the CYP51A 5’ flanking region 603 bp downstream the CYP51A start codon, 153
which is outside the construction cloned into the LMDM-P87. Homologous 154
or ectopic recombination would be confirmed by the amplification of two 155
fragments (3.5 kb and 386 bp) or one (386 bp) band, respectively. No 156
bands were expected in non-transformant strains. 157
158
PCR reactions. PCR amplifications were performed in a 25 µl volume 159
following the Pegasus DNA polymerase (PBL, Buenos Aires, Argentina) 160
manufacturer´s instructions in an Applied Biosystems thermocycler 161
(Tecnolab-AB, Buenos Aires, Argentina). The thermocycler was programed 162
for one initial step of 2 min at 94°C followed by 30 cycles of 30 s at 163
95°C, 30 s at primer´s pair Tm, and 1 min per Kb of the expected PCR 164
product at 72°C and then a final cycle of 10 min at 72ºC. 165
166
Confirmation of the expression of the mutated CYP51A. Total RNA was 167
extracted with RNAzol (RNAzol®RT – MRC Inc.) from mutant strains and 168
retro transcription (RT) was performed with AMV-RT enzyme (Promega, 169
Argentina) according to the manufacturer’s protocol. The obtained cDNA 170
was used as template for a PCR reaction performed with primers A1 – A10 171
(flanking the 70 bp intron of CYP51A). 172
173
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
8
Antifungal susceptibility testing. Susceptibility testing was performed 174
following the broth microdilution reference method published in the 175
document M38-A2 of the Clinical and Laboratory Standards Institute 176
(CLSI) (16). Itraconazole , posaconazole , voriconazole , fluconazole, 177
amphotericin B and caspofungin (all purchased in Sigma-Aldrich, 178
Argentina) were tested. Concentration ranges of fluconazole were 179
modified from what is standardized to 640 – 1.25 µg/ml to establish 180
differences in fluconazole susceptibilities between wild type and mutant 181
strains. Moreover, fluconazole and voriconazole susceptibility were also 182
evaluated by disk diffusion following the CLSI document M51-A (17) using 183
commercial disks (Oxoid, Argentina) and by agar diffusion using 184
fluconazole MIC-test strips (fluconazole 256 µg – MIC Test Strips – 185
Liofilchem ® SRL). Susceptibility tests were performed in triplicate in 186
three different days.187
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
1
RESULTS 188
189
To establish the role of the I301 residue of the Cyp51Ap in the A. fumigatus 190
intrinsic fluconazole resistance, two mutant strains were generated. One 191
harbors the mutation T793C in the CYP51A that leads to the I301T amino acid 192
substitution while the other is a CYP51A defective strain. Mutants were 193
named LMDM-1030 and LMDM-32, respectively. The homologous recombination was 194
confirmed by multiplex PCR using the primers described in material and 195
methods. The mutant strains LMDM-1030 and LMDM-32 showed the genomic 196
integration of the hph cassette (figure 2B-lanes 4 and 5, respectively). In 197
both mutants, two PCR bands were observed (386 bp and 1066 bp) corresponding 198
to the amplification of the DNA region between primers HS3/HS4 and A7/A10, 199
respectively. Similar results were obtained using LMDM-P87 and pUM-102 DNAs 200
which were used as reaction controls. On the other hand, parental strain 201
akuBKU80 showed only one 1066 bp band. The homologous recombination of both 202
constructions in LMDM-1030 and LMDM-32 were confirmed by a second multiplex 203
PCR. Two PCR bands were obtained when DNAs from both mutants were used 204
(Figure 2B- lanes 8 and 9). LMDM-1030 showed a 3.5 kb and a 386 bp bands 205
which correspond to the amplification using the primers A14 and HS4 and the 206
pair HS4 and HS3, respectively. The smaller band shows the hph presence. The 207
3.5 kb band demonstrate that the construction was integrated replacing the 208
wild type CYP51A since the A14 primer hybridize the CYP51A 5´UTR but in a 209
region not included in the construction (A14 hybridize 603 bp upstream of 210
the start codon). Moreover, the size of the amplicon demonstrate that the 211
hph cassette was integrated in the 3´UTR, 126 bp upstream of the CYP51A stop 212
codon. For LMDM-32, the multiplex PCR also showed two bands but with 213
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
2
different sizes (2.4 kb and 386 bp). The smaller band demonstrate the hph 214
cassette integration as described before, while the 2.4 kb band shows that 215
the hph cassette was integrated inside the CYP51A ORF region. As expected, 216
when A. fumigatus akuBKU80 DNAs was used no amplification was obtained 217
(Figure 2B- line 6). The incorporation of the T973C mutation in the CYP51A 218
gene of the LMDM-1030 mutant strain was confirmed by sequencing (Figure 2C). 219
The naturally occurring polymorphism T301I at A. fumigatus Cyp51Ap is 220
responsible of the fluconazole-resistance phenotype. The CYP51A defective 221
strain LMDM-32 and the T973C mutant LMDM-1030 were morphologically 222
indistinguishable from its parental strain A. fumigatus akuBKU80. However, 223
azole MIC values were substantially different. It was clear that the 224
deletion of CYP51A in LMDM-32 decreased the azole MIC values 32- to 4-fold 225
for fluconazole and the other azole drugs tested, respectively. In contrast, 226
LMDM-1030 MIC values were significantly lower only for fluconazole (32-fold) 227
(Table 2). As expected, there were no susceptibility differences to non-228
azole antifungals between mutants and parental strains (Table 2). The 229
fluconazoleand voriconazole susceptibility differences between wild type and 230
mutant strains were confirmed by Disk diffusion susceptibility testing. The 231
parental strain showed no inhibition zone when fluconazole disks were used 232
while the inhibition zone diameter for both mutant strains was 19 mm. 233
Turning to voriconazole, parental and LMDM-1030 strains showed the same 234
inhibition diameter (32 mm.) whereas the knock out mutant showed an 235
inhibition zone of 48 mm. (Table 2 and figure 3). Moreover, fluconazole MIC 236
differences between akuBKU80 and both mutants were also verified by agar 237
diffusion using Liofilchem MIC-test strips. Using this methodology, akuBKU80 238
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
3
strain showed a MIC of >256 µg/ml while both mutants exhibited 8 µg/ml (64-239
fold lower) (Table 2 and Figure 4). 240
CYP51A gene expression in LMDM-1030. The construction transformed into 241
LMDM-1030 carried a mutated CYP51A ORF with a 3´UTR modification (hph 242
insertion). The genomic integration of the construction could alter the 243
CYP51A gene transcription into mRNA, producing a decreased azole MIC 244
phenotype as the observed in CYP51A knock out strains (14). LMDM-1030 and 245
LMDM-32 strains showed low fluconazole MIC value. Thus, we decided to 246
evaluate the CYP51A expression during hyphal growth in order to determine 247
whether a loss of CYP51A expression might cause or contribute to the 248
fluconazole MIC change. Total RNA from akuBKU80 and LMDM-1030 strains were 249
extracted and retro-transcription reactions were carried out. Afterwards, 250
genomic DNA and cDNA from both strains were used as templates of PCR 251
reactions performed with the primers A1 and A10. These oligonucleotides 252
hybridize areas surrounding the intron of the CYP51A gene. Hence, fragments 253
of 350 bp and 425 bp were observed when cDNA and DNA from both strains were 254
used as template confirming the presence of CYP51A mRNA in both strains 255
(Figure 3). 256
257
Discussion 258
It is well known that A. fumigatus is intrinsically resistant to 259
fluconazolefluconazole and ketoconazole and normally susceptible to the 260
other available azole drugs (5,8). However, clinical secondary azole 261
resistance was described and mostly associated with several amino acid 262
substitution at Cyp51Ap (4,13,14,18-26). In 2005, Mellado et al. reported a 263
CYP51AΔ A. fumigatus mutant which was azole hyper-susceptible, confirming 264
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
4
the linkage between CYP51A and azole resistance (14). It is also clear that 265
each particular amino acid substitution in Cyp51Ap (or the combination of 266
them) leads to a particular azole MIC pattern and that most of the reported 267
CYP51A mutant strains showed itraconazole-resistance, itraconazole-268
posaconazole cross resistance, isavuconazole-voriconazole cross resistance 269
or pan-triazole cross resistance (4,13,14,18-26). Despite the advances in 270
elucidating the secondary azole resistance mechanisms in A. fumigatus, the 271
molecular basis of fluconazole intrinsic resistance was never studied. The 272
first hypothesis regarding this subject was proposed by Edlind et al. 273
studying A. fumigatus Cyp51Ap sequence (9). They suggested that the Cyp51Ap 274
I301 residue could be implicated in fluconazole-resistance since the T315A 275
substitution in the C. albicans Erg11p produce a similar phenotype. Later, 276
Diaz-Guerra et al. gave the first laboratory clue linking fluconazole 277
resistance with Cyp51Ap. They described that amino acid substitutions at the 278
G54 residue of the Cyp51Ap lead to itraconazole resistance but 4- to 5-fold 279
fluconazole MIC values reductions possibly due to a better interaction 280
between fluconazole and Cyp51Ap (13). 281
In this work, we obtained two A. fumigatus mutants, one harboring a I301T 282
substitution at its Cyp51Ap while the other is a CYP51A deletant. Both 283
mutants showed a 32-fold decrease in fluconazole MIC. To establish that 284
fluconazole susceptibility in the engineered A. fumigatus mutant is due to 285
the I301T change and not due to the loss of CYP51A, the expression of this 286
gene during hyphal growth was confirmed by retro-transcription. The MIC 287
values obtained for the other azole tested drugs also confirm that I301T 288
substitution is necessary and sufficient to explain fluconazole MIC 289
reduction. LMDM-1030 strain alone showed similar voriconazole, posaconazole 290
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
5
and itraconazole MIC to those obtained for its parental strain mimicking C. 291
albicans susceptibility patterns (pan-azole susceptibility) (27). 292
The precise manner in which I301T substitution impacts in fluconazole 293
susceptibility could be explained taking into account that in A. fumigatus 294
there are two homologous 14-CYP51 genes (28). In both Cyp51ps, four of the 295
five residues most frequently linked with fluconazole-resistance in C. 296
albicans are conserved (Y132, T315, S405, G464 and R467) (10,11). 297
Consequently, these amino-acid would not account for fluconazole resistance 298
in A. fumigatus. The fifth residue (T315) is conserved only in Cyp51Bp while 299
in Cyp51Ap is naturally replaced (I301). LMDM-1030 mutant harbors in both 300
Cyp51ps a threonine, as in C. albicans, thus both enzymes would be inhibited 301
by fluconazole. The T315 residue in the C. albicans 14-α sterol demethylase 302
is crucial for the correct enzyme-substrate and enzyme–drug interactions 303
near the haem group (11,29). Analogously, the A. fumigatus Cyp51Ap I301 is 304
placed in the center the α-I loop (D280-Q312) which was proposed as 305
essential for drug-enzyme interaction (30-35). Recently, Hargrove et al. 306
reported A. fumigatus Cyp51Bp crystal structure complexes obtained with and 307
without voriconazole. They confirmed that the residue T315 (equivalent to 308
I301 in Cyp51Ap) is part of the N-terminal portion of one of the substrate 309
recognition sequence (SRS4) which showed fungus-specific features not 310
observed in Cyp51p from other kingdoms. This data demonstrated the 311
importance of SRS4 in the specific inhibition of sterol biosynthesis in 312
fungi by azole drugs (31). Moreover, at the beginning of 2016, Liu et al. 313
reported a 3D structural model of the A. fumigatus Cyp51Ap based on a 314
crystal structure of the homologous Saccharomyces cerevisiae enzyme (Erg11p) 315
(32). Itraconazole, voriconazole and posaconazole were docked to wild type 316
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
6
and mutant Cyp51Ap and their model demonstrate that the S297 residue (part 317
of the αI helix) is adjacent to haem group and would interact with ligands 318
and azoles (32). When the Cyp51Ap αI helix is represented as a helical wheel 319
diagram, the I301 residue is the closest amino acid to S297 and would also 320
interact with azoles (data not shown). The experimental data that we present 321
in this work supports Liu et al. and Edlind et al. results (9, 32) and 322
strongly implicate the Cyp51Ap I301 residue in the A. fumigatus intrinsic 323
resistance to fluconazole. Moreover, this knowledge may help to understand 324
how the drugs interact with Cyp51Ap and would help in the development of new 325
antifungals. 326
327
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
7
Figure legends 328
329
Figure 1: Construction of the LMDM-P87 plasmid employed to generate the 330
A. fumigatus CYP51A T973C mutant strain. Striped and grey boxes represent 331
the CYP51A coding and UTRs sequences, respectively. Unfilled boxes indicate 332
the hygromycin resistance cassette (hph) obtained from the pUM102 plasmid. 333
Black arrows symbolize oligonucleotide primers. The X symbol represents the 334
introduced T973C mutation. SacI restriction sites are indicated with 335
scissors (primers H1 and H2). 336
Figure 2: Recombination confirmation. A) Schematic representation of the 337
gene constructions and primers relative positions. Striped and grey boxes 338
represent the CYP51A coding and UTRs sequences, respectively. Unfilled boxes 339
indicate the hygromycin resistance cassette (hph). Black boxes show the 340
CYP51A UTRs not included in the constructions. Lines (in LMDM-P87 and pUM-341
102) represent pGemT-easy vector. Arrows symbolize oligonucleotide primers. 342
The X symbol represents the introduced T973C mutation. Dotted lines 343
represent the size (in bp) of the PCR fragments. B) Multiplex PCR reactions 344
aimed to confirm homologous recombination events in the studied mutants. 345
Lanes 1 to 5 show the results of the multiplex PCR designed to verify the 346
hph cassette integration (primers A7/A10 and HS3/HS4). Lanes 6 to 10 show 347
the amplification products of the multiplex PCR meant to confirm the 348
homologous recombination of the mutated CYP51A (primers A14, HS3 and HS4). 349
M: 100 bp ladder. Lanes 1 and 6: Wild type akuBKU80. Lanes 2 and 7: LMDM-P87. 350
Lanes 3 and 8: LMDM-1030. Lanes 4 and 9: LMDM-32. Lanes 5 and 10: pUM-102. 351
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
8
C) Sequencing chromatograms showing the mutation T973C at the CYP51A gene of 352
the LMDM-1030 strain. 353
354
Figure 3: Agarose gel electrophoresis showing the detection of CYP51A 355
transcripts. Lanes 1 and 2, PCR products using genomic DNAs. Lanes 3 and 4, 356
PCR amplification using cDNAs as template. Lanes 1 and 3, A. fumigatus 357
akuBKU80. Lanes 2 and 4, LMDM-1030. 358
359
Figure 4: Diffusion susceptibility testing using fluconazole (FLC) disks and 360
Liofilchem MIC test strips and voriconazole (VRC) disks for A. fumigatus 361
LMDM-1030 (I301T Cyp51Ap mutant), A. fumigatus akuBKU80 (parental strain) and 362
A. fumigatus LMDM-32 (CYP51AΔ). 363
364
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
1
365
Table 1. Oligonucleotide primers used in this work. 366
367
Primer Sequence (5’- 3’) * Orientation Use
A7 1 TCATATGTTGCTCAGCGG Sense LMDM-P87 construction and evaluation of the transforming vector integration.
A19 GCATAATCCAGGCGCTGGTGGACGAAGACGAATGC Antisense LMDM-P87 construction.A18 GCATTCGTCTTCGTCCACCAGCGCCTGGATTATGC Sense LMDM-P87 construction.A17 GGCCAGTAAGGTCTGAATAAG Antisense LMDM-P87 construction.H1 TTTGAGCTCGTTAACTGATATTGAAGGAGCATTTTTTGGGC Sense LMDM-P87 construction.H2 ACGGAGCTCCATCGAACCTCTCGTGTGACTATG Antisense LMDM-P87 construction.HF1 AGAGTAGATGCCGACCGGGAACCAGTTAACCCTGAAGTGTTGTTGCCTATACTGAG Sense LMDM-P87 construction.HF2 CTCAGTATAGGCAACAACACTTCAGGGTTAACTGGTTCCCGGTCGGCATCTACTCT Antisense LMDM-P87 construction.P450-1 2 ATGGTGCCGATGCTATGG Sense CYP51A knock-out cassette amplification. P450-2 2 CTGTCTCACTTGGATGTG Antisense CYP51A knock-out cassette amplification.
A10 ATTGCCGCAGAGATGTCC Antisense Evaluation of the transforming vector integration and CYP51A expression.
HS3 ACATGGCGTGATTTCATATGCGCG Sense Evaluation of the transforming vector integration.
HS4 TGGTCAAGACCAATGCGGAGCATA Antisense Evaluation of the transforming vector integration.
A14 CCAGAGAGACTTTGACACAG Sense
Evaluation of the transforming vector integration.
A1 1 CTTCTTTGCGTGCAGAGA Sense Evaluation of CYP51A expression. 368
* Letters in bold indicate the mutated nucleotide. Underlining indicates a SacI restriction site. 369
1 Mellado et al. (28) 370
2 Diaz-Guerra et al. (13) 371
372
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
1
Table 2: Susceptibility testing results of the Aspergillus fumigatus 373
strains used in this study. 374
Antifungal agent a Strains FLC ITC PCZ VRC AMB CSF A. fumigatus akuBKU80
640.00 (>256.00/0)
0.12 0.250.12 (ND/32)
0.50 0.06
LMDM-1030 20.00 (8.00/19)
0.06 0.250.12 (ND/32)
0.50 0.06
LMDM-32 20.00 (8.00/19)
0.03 0.060.03 (ND/48)
0.50 0.06
a Geometric mean of at least 3 repetitions performed in different days. 375
MIC values expressed in µg/ml. FLC: Fluconazole, ITC: Itraconazole, PCZ: 376
Posaconazole, VRC: Voriconazole, AMB: Amphotericin B, CSF: Caspofungin. In 377
parenthesis are the MIC and diameter values obtained by agar diffusion for 378
fluconazole and voriconazole (Liofilchem MIC test strips/inhibition diameter 379
in mm.). ND: Not done. 380
381
382
383
384
ACKNOWLEDGMENTS 385
This study was supported in part by Science, Technology and Productive 386
Innovation Ministry (MinCyT - Argentina) grant PICT2013/1571 to G.G.E. C.D. 387
and F.L. have a fellowship from CONICET (Argentina). D.M. has a fellowship 388
from MinCyT (Argentina). M.S.C. has a postdoctoral fellowship from CONICET. 389
390
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
2
391
392
Reference List 393
394
1. Doligalski, C. T., K. Benedict, A. A. Cleveland, B. Park, G. Derado, P. 395 G. Pappas, J. W. Baddley, D. W. Zaas, M. T. Harris, and B. D. Alexander. 396 2014. Epidemiology of invasive mold infections in lung transplant 397 recipients. Am.J.Transplant. 14:1328-1333. doi:10.1111/ajt.12691 [doi]. 398
2. Pappas, P. G., B. D. Alexander, D. R. Andes, S. Hadley, C. A. Kauffman, 399 A. Freifeld, E. J. Anaissie, L. M. Brumble, L. Herwaldt, J. Ito, D. P. 400 Kontoyiannis, G. M. Lyon, K. A. Marr, V. A. Morrison, B. J. Park, T. F. 401 Patterson, T. M. Perl, R. A. Oster, M. G. Schuster, R. Walker, T. J. 402 Walsh, K. A. Wannemuehler, and T. M. Chiller. 2010. Invasive fungal 403 infections among organ transplant recipients: results of the Transplant-404 Associated Infection Surveillance Network (TRANSNET). Clin.Infect.Dis. 405 50:1101-1111. doi:10.1086/651262 [doi]. 406
3. Steinbach, W. J., K. A. Marr, E. J. Anaissie, N. Azie, S. P. Quan, H. U. 407 Meier-Kriesche, S. Apewokin, and D. L. Horn. 2012. Clinical epidemiology 408 of 960 patients with invasive aspergillosis from the PATH Alliance 409 registry. J.Infect. 65:453-464. doi:S0163-4453(12)00220-4 410 [pii];10.1016/j.jinf.2012.08.003 [doi]. 411
4. Garcia-Effron, G., A. Dilger, L. Alcazar-Fuoli, S. Park, E. Mellado, and 412 D. S. Perlin. 2008. Rapid detection of triazole antifungal resistance in 413 Aspergillus fumigatus. J.Clin.Microbiol. 46:1200-1206. doi:JCM.02330-07 414 [pii];10.1128/JCM.02330-07 [doi]. 415
5. Gregson, L., J. Goodwin, A. Johnson, L. McEntee, C. B. Moore, M. 416 Richardson, W. W. Hope, and S. J. Howard. 2013. In vitro susceptibility 417 of Aspergillus fumigatus to isavuconazole: correlation with 418 itraconazole, voriconazole, and posaconazole. Antimicrob.Agents 419 Chemother. 57:5778-5780. doi:AAC.01141-13 [pii];10.1128/AAC.01141-13 420 [doi]. 421
6. Pfaller, M. A., D. J. Diekema, M. A. Ghannoum, J. H. Rex, B. D. 422 Alexander, D. Andes, S. D. Brown, V. Chaturvedi, A. Espinel-Ingroff, C. 423 L. Fowler, E. M. Johnson, C. C. Knapp, M. R. Motyl, L. Ostrosky-424 Zeichner, D. J. Sheehan, and T. J. Walsh. 2009. Wild-type MIC 425 distribution and epidemiological cutoff values for Aspergillus fumigatus 426 and three triazoles as determined by the Clinical and Laboratory 427 Standards Institute broth microdilution methods. J.Clin.Microbiol. 428 47:3142-3146. doi:JCM.00940-09 [pii];10.1128/JCM.00940-09 [doi]. 429
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
3
7. Rodriguez-Tudela, J. L., L. Alcazar-Fuoli, E. Mellado, A. Alastruey-430 Izquierdo, A. Monzon, and M. Cuenca-Estrella. 2008. Epidemiological 431 cutoffs and cross-resistance to azole drugs in Aspergillus fumigatus. 432 Antimicrob.Agents Chemother. 52:2468-2472. doi:AAC.00156-08 433 [pii];10.1128/AAC.00156-08 [doi]. 434
8. Walsh, T. J., E. J. Anaissie, D. W. Denning, R. Herbrecht, D. P. 435 Kontoyiannis, K. A. Marr, V. A. Morrison, B. H. Segal, W. J. Steinbach, 436 D. A. Stevens, J. A. van Burik, J. R. Wingard, and T. F. Patterson. 437 2008. Treatment of aspergillosis: clinical practice guidelines of the 438 Infectious Diseases Society of America. Clin.Infect.Dis. 46:327-360. 439 doi:10.1086/525258 [doi]. 440
9. Edlind, T. D., K. W. Henry, K. A. Metera, and S. K. Katiyar. 2001. 441 Aspergillus fumigatus CYP51 sequence: potential basis for fluconazole 442 resistance. Med.Mycol. 39:299-302. 443
10. Lamb, D. C., D. E. Kelly, W. H. Schunck, A. Z. Shyadehi, M. Akhtar, D. 444 J. Lowe, B. C. Baldwin, and S. L. Kelly. 1997. The mutation T315A in 445 Candida albicans sterol 14alpha-demethylase causes reduced enzyme 446 activity and fluconazole resistance through reduced affinity. 447 J.Biol.Chem. 272:5682-5688. 448
11. Marichal, P., L. Koymans, S. Willemsens, D. Bellens, P. Verhasselt, W. 449 Luyten, M. Borgers, F. C. Ramaekers, F. C. Odds, and H. V. Bossche. 450 1999. Contribution of mutations in the cytochrome P450 14alpha-451 demethylase (Erg11p, Cyp51p) to azole resistance in Candida albicans. 452 Microbiology 145 (Pt 10):2701-2713. 453
12. da Silva Ferreira, M. E., M. R. Kress, M. Savoldi, M. H. Goldman, A. 454 Hartl, T. Heinekamp, A. A. Brakhage, and G. H. Goldman. 2006. The 455 akuB(KU80) mutant deficient for nonhomologous end joining is a powerful 456 tool for analyzing pathogenicity in Aspergillus fumigatus. Eukaryot.Cell 457 5:207-211. doi:5/1/207 [pii];10.1128/EC.5.1.207-211.2006 [doi]. 458
13. Diaz-Guerra, T. M., E. Mellado, M. Cuenca-Estrella, and J. L. Rodriguez-459 Tudela. 2003. A point mutation in the 14alpha-sterol demethylase gene 460 cyp51A contributes to itraconazole resistance in Aspergillus fumigatus. 461 Antimicrob.Agents Chemother. 47:1120-1124. 462
14. Mellado, E., G. Garcia-Effron, M. J. Buitrago, L. Alcazar-Fuoli, M. 463 Cuenca-Estrella, and J. L. Rodriguez-Tudela. 2005. Targeted gene 464 disruption of the 14-alpha sterol demethylase (cyp51A) in Aspergillus 465 fumigatus and its role in azole drug susceptibility. Antimicrob.Agents 466 Chemother. 49:2536-2538. doi:49/6/2536 [pii];10.1128/AAC.49.6.2536-467 2538.2005 [doi]. 468
15. Pontecorvo, G., J. A. Roper, L. M. Hemmons, K. D. Mac Donald, and A. W. 469 Bufton. 1953. The genetics of Aspergillus nidulans. Adv.Genet. 5:141-470 238. 471
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
4
16. Clinical and Laboratory Standards Institute. Reference method for broth 472 diution antifungal susceptibility Testing of Filamentous Fungi, Approved 473 Standard Second Edition. Document M38-A2. 28(16). 2008. 474
17. Clinical and Laboratory Standards Institute. Method for Antifungal Disk 475 Diffusion Susceptibility Testing of Non-Dermatophyte Filamentous Fungi. 476 Aproved Guidelines. CLSI Document M51-A. 2010. 477
478
18. Bellete, B., H. Raberin, J. Morel, P. Flori, J. Hafid, and R. T. 479 Manhsung. 2010. Acquired resistance to voriconazole and itraconazole in 480 a patient with pulmonary aspergilloma. Med.Mycol. 48:197-200. 481 doi:10.3109/13693780902717018 [doi]. 482
19. Camps, S. M., J. W. van der Linden, Y. Li, E. J. Kuijper, J. T. van 483 Dissel, P. E. Verweij, and W. J. Melchers. 2012. Rapid induction of 484 multiple resistance mechanisms in Aspergillus fumigatus during azole 485 therapy: a case study and review of the literature. Antimicrob.Agents 486 Chemother. 56:10-16. doi:AAC.05088-11 [pii];10.1128/AAC.05088-11 [doi]. 487
20. Denning, D. W., S. Park, C. Lass-Florl, M. G. Fraczek, M. Kirwan, R. 488 Gore, J. Smith, A. Bueid, C. B. Moore, P. Bowyer, and D. S. Perlin. 489 2011. High-frequency triazole resistance found In nonculturable 490 Aspergillus fumigatus from lungs of patients with chronic fungal 491 disease. Clin.Infect.Dis. 52:1123-1129. doi:cir179 492 [pii];10.1093/cid/cir179 [doi]. 493
21. Howard, S. J., I. Webster, C. B. Moore, R. E. Gardiner, S. Park, D. S. 494 Perlin, and D. W. Denning. 2006. Multi-azole resistance in Aspergillus 495 fumigatus. Int.J.Antimicrob.Agents 28:450-453. doi:S0924-8579(06)00326-8 496 [pii];10.1016/j.ijantimicag.2006.08.017 [doi]. 497
22. Howard, S. J., D. Cerar, M. J. Anderson, A. Albarrag, M. C. Fisher, A. 498 C. Pasqualotto, M. Laverdiere, M. C. Arendrup, D. S. Perlin, and D. W. 499 Denning. 2009. Frequency and evolution of Azole resistance in 500 Aspergillus fumigatus associated with treatment failure. 501 Emerg.Infect.Dis. 15:1068-1076. doi:10.3201/eid1507.090043 [doi]. 502
23. Mann, P. A., R. M. Parmegiani, S. Q. Wei, C. A. Mendrick, X. Li, D. 503 Loebenberg, B. DiDomenico, R. S. Hare, S. S. Walker, and P. M. 504 McNicholas. 2003. Mutations in Aspergillus fumigatus resulting in 505 reduced susceptibility to posaconazole appear to be restricted to a 506 single amino acid in the cytochrome P450 14alpha-demethylase. 507 Antimicrob.Agents Chemother. 47:577-581. 508
24. Mellado, E., G. Garcia-Effron, L. Alcazar-Fuoli, M. Cuenca-Estrella, and 509 J. L. Rodriguez-Tudela. 2004. Substitutions at methionine 220 in the 510 14alpha-sterol demethylase (Cyp51A) of Aspergillus fumigatus are 511 responsible for resistance in vitro to azole antifungal drugs. 512 Antimicrob.Agents Chemother. 48:2747-2750. doi:10.1128/AAC.48.7.2747-513 2750.2004 [doi];48/7/2747 [pii]. 514
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
5
25. Mellado, E., G. Garcia-Effron, L. Alcazar-Fuoli, W. J. Melchers, P. E. 515 Verweij, M. Cuenca-Estrella, and J. L. Rodriguez-Tudela. 2007. A new 516 Aspergillus fumigatus resistance mechanism conferring in vitro cross-517 resistance to azole antifungals involves a combination of cyp51A 518 alterations. Antimicrob.Agents Chemother. 51:1897-1904. doi:AAC.01092-06 519 [pii];10.1128/AAC.01092-06 [doi]. 520
26. Verweij, P. E., E. Mellado, and W. J. Melchers. 2007. Multiple-triazole-521 resistant aspergillosis. N.Engl.J.Med. 356:1481-1483. doi:356/14/1481-a 522 [pii];10.1056/NEJMc061720 [doi]. 523
27. Pfaller, M. A. and D. J. Diekema. 2007. Epidemiology of invasive 524 candidiasis: a persistent public health problem. Clin Microbiol Rev. 525 20:133-163. 526
28. Mellado, E., T. M. Diaz-Guerra, M. Cuenca-Estrella, and J. L. Rodriguez-527 Tudela. 2001. Identification of two different 14-alpha sterol 528 demethylase-related genes (cyp51A and cyp51B) in Aspergillus fumigatus 529 and other Aspergillus species. J.Clin.Microbiol. 39:2431-2438. 530 doi:10.1128/JCM.39.7.2431-2438.2001 [doi]. 531
29. Sanglard, D., F. Ischer, L. Koymans, and J. Bille. 1998. Amino acid 532 substitutions in the cytochrome P-450 lanosterol 14alpha-demethylase 533 (CYP51A1) from azole-resistant Candida albicans clinical isolates 534 contribute to resistance to azole antifungal agents. Antimicrob.Agents 535 Chemother. 42:241-253. 536
30. Debnath, S. and S. Addya. 2014. Structural basis for heterogeneous 537 phenotype of ERG11 dependent Azole resistance in C. albicans clinical 538 isolates. Springerplus. 3:660. doi:10.1186/2193-1801-3-660 [doi];1366 539 [pii]. 540
31. Hargrove, T. Y., Z. Wawrzak, D. C. Lamb, F. P. Guengerich, and G. I. 541 Lepesheva. 2015. Structure-Functional Characterization of Cytochrome 542 P450 Sterol 14alpha-Demethylase (CYP51B) from Aspergillus fumigatus and 543 Molecular Basis for the Development of Antifungal Drugs. J.Biol.Chem. 544 290:23916-23934. doi:M115.677310 [pii];10.1074/jbc.M115.677310 [doi]. 545
32. Liu, M., N. Zheng, D. Li, H. Zheng, L. Zhang, H. Ge, and W. Liu. 2016. 546 cyp51A-based mechanism of azole resistance in Aspergillus fumigatus: 547 Illustration by a new 3D Structural Model of Aspergillus fumigatus 548 CYP51A protein. Med Mycol. 54:400-408. doi:myv102 549 [pii];10.1093/mmy/myv102 [doi]. 550
33. Oliveira, C., V, T. S. Okay, M. S. Melhem, S. M. Walderez, and G. M. del 551 Negro. 2013. The new mutation L321F in Candida albicans ERG11 gene may 552 be associated with fluconazole resistance. Rev Iberoam.Micol. 30:209-553 212. doi:S1130-1406(13)00013-2 [pii];10.1016/j.riam.2013.01.001 [doi]. 554
34. van Nistelrooy, J. G., J. M. van den Brink, J. A. van Kan, R. F. van 555 Gorcom, and M. A. de Waard. 1996. Isolation and molecular 556
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
6
characterisation of the gene encoding eburicol 14 alpha-demethylase 557 (CYP51) from Penicillium italicum. Mol.Gen.Genet. 250:725-733. 558
35. Warrilow, A. G., J. E. Parker, D. E. Kelly, and S. L. Kelly. 2013. Azole 559 affinity of sterol 14alpha-demethylase (CYP51) enzymes from Candida 560 albicans and Homo sapiens. Antimicrob.Agents Chemother. 57:1352-1360. 561 doi:AAC.02067-12 [pii];10.1128/AAC.02067-12 [doi]. 562
563 564
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
C973T
x
LMDM-P75
A7 A17
X CYP51A 3’UTR hph
LMDM-P82
H1 H2
HF1 A7
A17 X
A18
A19 X
H2 HF2
hph
pUM102
H1
A7
LMDM-P87
H2
CYP51A 3’UTR hph X
Figure 1
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
Figure 2
200 bp
X A10 A7
1066 bp
A14
Wild type akuBKU80
A10 A7
1066 bp
A14
HS4 HS3
386 bp
HS4 HS3
2.4 kb
LMDM-32
X A10 A7
1066 bp
A14
HS4 HS3
386 bp
HS4 HS3
3.5 kb
LMDM-1030
X A10 A7
1066 bp
HS4 HS3
386 bp
HS4 HS3
LMDM-P87
A10 HS4 HS3
386 bp
pUM-102
A
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
1 2 3 4 5 M 6 7 8 9 10 B
Wild type akuBKU80 LMDM-1030 C
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
M 1 2 3 4
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from
A. fumigatus
akuBKU80
LMDM-1030
(I301T Cyp51Ap)
LMDM-32 (CYP51AΔ)
FLC – disks
VRC – disks
FLC – e-test
on July 19, 2016 by University of M
anchester Libraryhttp://aac.asm
.org/D
ownloaded from