N 4V O L 4 1

2 0 0 9

REVISTA ARGENTINA DEM I C R O B I O L O G A

PUBLICACIN DE LA

ASOCIACIN ARGENTINADE

MICROBIOLOGA

PUBLICACION DE LA ASOCIACION ARGENTINA DE MICROBIOLOGIA

Secretara: Den Funes 472, C1214AAD Buenos Aires; Tel/FAX: 54-11-4932-8858, 54-11-4932-8948; E-mail: info@aam.org.ar, http://www.aam.org.ar

SUSCRIPCIN (cuatro nmeros anuales)Socios AAM U$ 100Argentina no socios U$ 200Amrica Latina U$S 100Otros pases U$S 150

Los pagos pueden hacerse por giros a la orden de Asociacin Argentina de Microbiologa.

Personera Jurdica 000908.Registro Nacional de la Propiedad Intelectual N 269649.I.S.S.N. 0325-7541

Corre

oAr

gent

ino

Suc.

4 -

B Franqueo PagadoConcesin N 4195

Tarifa ReducidaConcesin N 628

DIRECTORASilvia Carla Predari

SECRETARIO DE REDACCINGerardo A. Leotta

COMIT EDITORAlicia I. Arechavala

Daniel GrassoAna M. Jar

Claudia I. MenghiElsa C. Mercado

Hctor R. MorbidoniVilma Savy

ASESORES CIENTFICOS

Aparece en Biological Abstracts, Chemical Abstracts, Veterinary Bulletin, Index Veterinario, EMBASE (Excerpta Medica)Medline (Index Medicus), Tropical Diseases Bulletin, Abstracts on Hygiene and Communicable Diseases, Literatura Latinoa-mericana en Ciencias de la Salud (LILACS), Peridica, LATINDEX, SciELO y Science Citation Index Expanded.

C. BantarJ.C. BaslicoM.I. Berra

H.M. BianchiniN. BinszteinM.M. Bracco

R.A. CacchioneR. CamposG. Carballal

J.J. CazzuloC. Coto

M. DAquinoR. de Torres

J.E. GonzlezS. Gonzlez Ayala

A.H. FradeN. LeardiniH. Lopardo

W.P. Mac CormackD. Masih

E. MassouhM.A.M. de Asconegui

R. NegroniF. Nicola

T. OrdunaJ.L. Parada

A.P. de Ruiz Holgado

ASESORES EN EL EXTERIOR

H.R. RodrguezA. SchudelL. ScolaroR. SoloagaD. SordelliH. Terzolo

G. VaamondeM. Weissenbacher

J. Arbiza (Uruguay)E. Garca Lpez (Espaa)M. Gottschalk (Canad)R. Guerrero (Espaa)

M.J. Mendes Giannini (Brasil)M. Philipp (EE.UU)J. Pontn (Espaa)

F. Queiroz Telles (Brasil)A. Restrepo (Colombia)

G. San Blas (Venezuela)G. Schmunis (EE.UU)

A. Steinbchel (Alemania)M. Tolmasky (EE.UU)

J. Vila Estape (Espaa)

XII CONGRESO ARGENTINODE MICROBIOLOGA24 al 27 de octubre de 2010

Palais RougeJernimo Salguero 1433/49 (C1177AFA)

Ciudad Autnoma de Buenos Aires, Argentina

Presidente: Ricardo Negroni

Vicepresidentes: Isabel BogadoJorge ReinheimerMarta Tokumoto

Secretarias Generales: Alicia ArechavalaMara Alejandra Picconi

Prosecretaria: Cristina Iovannitti

Tesorera: Adriana De PaulisProtesorera: Paula Gagetti

Secretaria de Relaciones Institucionales: Daniela Centrn

Secretaria Tcnica: Adriana ScariComisin Tcnica: Manuel Gmez Carrillo, Cecilia Quiroga y

Soledad Ramrez

Secretarios Cientficos: Liliana GuelfandHoracio Salomn

Comisin Cientfica: Carlos Vay

Representantes de las Divisiones en el Comit Cientfico y Comit OrganizadorDivisin Agrcola y Ambiental: Ins Garca y Susana Vzquez

Divisin DAMYC: Virginia Fernndez Pinto y Guillermo GuirnDivisin SADEBAC: Mirta Litterio y Magdalena Pennini

Divisin SAV: Viviana Mbayed y Victoria Preciado

Vocales: Marina Bottiglieri (Filial Crdoba)Perla Hermida Lucena (Filial Rosario) Luis Merino (Filial NEA)Ana Paris de Baeza (Filial Sur)Francisco Salamone (Filial Santa Fe)Alejandro Sturniolo (Filial Cuyo)Ada Surez (Filial NOA)

Para ms informacin y/o sugerencias puede contactarnos ainfo@aam.org.ar

Xxxx 1ISSN 0325-7541Revista Argentina de Microbiologa (2008) 40: ---XXX

VOLUMEN 41 N 4 lllll OCTUBRE-DICIEMBRE DE 2009

* En ingls

NDICE

EDITORIALTransferencia e intercambio de conocimiento a travs de reuniones cientficas. Cerca del coraznde los amigos, lejos de las arcas del EstadoH.R. Morbidoni

MICROBIOLOGA BSICA*Amplificacin del genoma completo del subtipo 2 del virus de la influenza equinaG.H. Sguazza, N.A. Fuentealba, M.A. Tizzano, C.M. Galosi, M.R. Pecoraro

MICROBIOLOGA CLNICA Y ENFERMEDADES INFECCIOSASBrote de micoplasmosis clnica por Mycoplasma ovis en ovinos de Salta, Argentina. Diagnsticoclnico, microbiolgico y molecularD.H. Aguirre, C. Thompson, R.D. Neumann, A.O. Salatin, A.B. Gaido, S. Torioni de Echaide*Mycobacterium bovis en Argentina: aislamientos de gatos tipificados por spoligotypingM.J. Zumrraga, M. Martnez Vivot, D. Marticorena, A. Bernardelli, R. Fasn, R. Iachini, A.A. Cataldi*Echinococcus granulosus: comparacin biolgica de aislados de bovinos de regiones endmi-cas de Argentina y EspaaM.V. Andresiuk, F. Ponce Gordo, C. Cuesta Bandera, M.C. Elissondo, M. Dopchiz, G. Denegri

AGENTES ANTIMICROBIANOS*Actividad antibacteriana y antioxidante del aceite esencial extrado de Artemisia echegarayi Hieron.(Asteraceae)A. Laciar, M.L. Vaca Ruiz, R. Carrizo Flores, J.R. Saad

MICROBIOLOGA DE ALIMENTOS*El t de tilo como vehculo potencial de esporas de Clostridium botulinum en la transmisin delbotulismo infantilM.I. Bianco, C. Lquez, L.I.T. de Jong, R.A. FernndezModelo de contaminacin cruzada por Escherichia coli verocitotoxignica durante la elaboracinde hamburguesas caseras y evaluacin cuantitativa de riesgosM.L. Signorini, L.S. Frizzo

MICROBIOLOGA INDUSTRIAL Y AMBIENTAL*Evolucin del contenido de ocratoxina A en vinos tintos argentinos durante el proceso devinificacin a escala pilotoM.L. Ponsone, M.L. Chiotta, M. Combina, A.M. Dalcero, S.N. Chulze

ARTCULO ESPECIALToxinas de Clostridium perfringensW.E. Morris, M.E. Fernndez-Miyakawa

IMGENES MICROBIOLGICAS*Efecto citoptico en clulas BHK 21 (C13) inoculadas con Leptospira interrogans serovar Pomonaaislada de un aborto porcinoB. Brihuega, A. Venzano, O. Zabal, D. Funes, C. Auteri, G. Romero, L. Samartino*Consorcio bacteriano degradador de hidrocarburos aislado de suelos de AntrtidaL.A.M. Ruberto, S.C. Vzquez, W.P. Mac Cormack

ndice general del volumen 41ndice de temasndice de autoresAgradecimiento a revisoresFe de erratasInstrucciones para los autores

203

207

212

215

218

226

232

237

245

251

261

262

263269271272272273

2 Revista Argentina de Microbiologa (2008) 40: ---

VOLUMEN 41 N 4 lllll OCTOBER-DECEMBER 2009

* In English

INDEX

EDITORIALExchange of scientific information through scientific meetings: close to our friends hearts, faraway from the purse of the StateH.R. Morbidoni

GENERAL MICROBIOLOGY*Complete genome amplification of Equine influenza virus subtype 2G.H. Sguazza, N.A. Fuentealba, M.A. Tizzano, C.M. Galosi, M.R. Pecoraro

CLINICAL MICROBIOLOGY AND INFECTIOUS DISEASESClinical mycoplasmosis outbreak due to Mycoplasma ovis in sheep from Salta, Argentina. Clinical,microbiological and molecular diagnosisD.H. Aguirre, C. Thompson, R.D. Neumann, A.O. Salatin, A.B. Gaido, S. Torioni de Echaide*Mycobacterium bovis in Argentina: isolates from cats typified by spoligotypingM.J. Zumrraga, M. Martnez Vivot, D. Marticorena, A. Bernardelli, R. Fasn, R. Iachini, A.A. Cataldi*Echinococcus granulosus: biological comparison of cattle isolates from endemic regions of Ar-gentina and SpainM.V. Andresiuk, F. Ponce Gordo, C. Cuesta Bandera, M.C. Elissondo, M. Dopchiz, G. Denegri

ANTIMICROBIAL AGENTS*Antibacterial and antioxidant activities of essential oil of Artemisia echegarayi Hieron. (Asteraceae)A. Laciar, M.L. Vaca Ruiz, R. Carrizo Flores, J.R. Saad

FOOD MICROBIOLOGY*Linden flower (Tilia spp.) as vehicle of Clostridium botulinum spores in the transmission of infantbotulismM.I. Bianco, C. Lquez, L.I.T. de Jong, R.A. FernndezQuantitative risk model for verocytotoxigenic Escherichia coli cross-contamination duringhamburger preparationM.L. Signorini, L.S. Frizzo

INDUSTRIAL AND ENVIRONMENTAL MICROBIOLOGY*Fate of ochratoxin A content in Argentinean red wine during a pilot scale vinificationM.L. Ponsone, M. Combina, A.M. Dalcero, S.N. Chulze

SPECIAL ARTICLESToxins of Clostridium perfringensW.E. Morris, M.E. Fernndez-Miyakawa

MICROBIOLOGICAL IMAGES*Cytopathic effect in BHK 21 (C13) cells inoculated with Leptospira interrogans serovar Pomonaisolated from a porcine abortionB. Brihuega, A. Venzano, O. Zabal, D. Funes, C. Auteri, G. Romero, L. Samartino*Bacterial hydrocarbon-degrading consortium from Antarctic soilsL.A.M. Ruberto, S.C. Vzquez, W.P. Mac Cormack

General Index of volume 41Subject indexIndex by authorAcknowledgement to reviewersErrataInstructions to authors

203

207

212

215

218

226

232

237

245

251

261

262

263269271272272273

Editorial 203ISSN 0325-7541Revista Argentina de Microbiologa (2009) 41: 203-206EDITORIAL

Transferencia e intercambio de conocimiento a travs dereuniones cientficas: cerca del corazn de los amigos,

lejos de las arcas del EstadoAl poseedor de las riquezas no le hace dichoso el tenerlas, sino el

gastarlas, y no el gastarlas como quiera, sino el saberlas gastar.

Miguel de Cervantes

Mycobacterium tuberculosis, la bacteria causante de la tuberculosis humana, es uno de los patgenosms efectivos de la naturaleza, ya que una persona se puede infectar por la inhalacin de 1 a 5 bacilos.Sin embargo, el sistema inmune puede rpidamente controlar a este patgeno e impedir la enfermedad.An con este escenario, se estima que un tercio de la poblacin mundial est infectada, y que por ao 10millones de personas enferman y 2 millones mueren a causa de esta bacteria (3). La incidencia de estapatologa en la salud humana fue potenciada por los altos nmeros de casos de enfermos infectados porvih que desarrollan Sida. Dado el efecto devastador del Sida sobre el sistema inmune, el bacilo tubercu-loso encuentra un husped en el cual no existen barreras para su control y contencin. El tratamiento dela tuberculosis es extremadamente prolongado: requiere el empleo de cinco drogas durante dos meses,seguido por la administracin de dos drogas por espacio de cuatro meses; en otras palabras, mltiplestomas de numerosos medicamentos. Este hecho supone una gran dificultad en la adhesin al tratamien-to por parte del paciente, a lo que se suman otras circunstancias como la lejana de los centros de salud,los efectos secundarios de una o ms drogas y, an ms grave, casos en los que el paciente comienzaa notar una mejora fsica como resultado de los frmacos y suspende el tratamiento.

Entre las estrategias implementadas por la Organizacin Mundial de la Salud se destaca aquellaconocida como tratamiento acortado estrictamente supervisado o TAES, consistente en la observacindirecta del cumplimiento del tratamiento (ingestin de los frmacos) a cargo de una persona entrenadaperteneciente al sistema formal de salud o un voluntario debidamente capacitado para ese fin. El TAESest basado en cinco principios clave (5): intervencin organizada y sostenida, identificacin de casosen forma temprana y precisa, quimioterapia eficaz y fcil de ser administrada, manejo eficaz de losmedicamentos y monitoreos basados en los resultados. Estos principios se cumplen a travs de loscomponentes del TAES como lo son el compromiso gubernamental para asegurar acciones de luchaantituberculosa completas y sostenidas, la deteccin de casos en pacientes sintomticos mediante tc-nicas microscpicas, el tratamiento normalizado de corta duracin durante 6-8 meses, el suministroregular de frmacos antituberculosos, un sistema de comunicacin y registro normalizado para evaluarla deteccin de casos y el resultado del tratamiento instaurado para cada paciente.

Estas normas, junto con un plan de inversin de organismos oficiales nacionales y de organizacionesfilantrpicas, tienen como objetivo disminuir sensiblemente el nmero de casos de tuberculosis y demuertes producidas por esta enfermedad en el mundo para el ao 2015 (3). Al presente, los resultadosfueron dispares, mientras la deteccin y el tratamiento de nuevos casos ha funcionado eficientemente,ya que se lleg a valores cercanos a los establecidos como metas, otros componentes como el avanceen la implementacin y planificacin en algunas regiones de frica y Asia y, fundamentalmente, lasdificultades en el tratamiento de las formas resistentes a las drogas han quedado lejos de los propsitos.Desde el punto de vista financiero, los fondos disponibles en el ao 2008 fueron de 3.300 millones deUS$ para 90 pases que concentran el 91% del total de casos de tuberculosis. Sin embargo, hubo

204 Revista Argentina de Microbiologa (2009) 41: 203-206

diferencias sustanciales entre los fondos requeridos y los percibidos por pases donde las actividades deprogramas TB/vih y el manejo de casos de tuberculosis multirresistente (MDR-TB) requieren ms dinero.

El progreso en la deteccin de casos comenz a declinar en trminos globales en 2006, sobre todoen China e India, y sigue siendo bajo en frica; esto indica la perentoria necesidad de acelerar losavances en el control global de la tuberculosis si se quiere alcanzar las metas propuestas en un lapsorazonable. Sin embargo, una de las razones que impide la concrecin de estos objetivos es la diferenciaen asignacin y uso de fondos en Asia y Europa.

En Argentina, durante el ao 2007 se notificaron 10.683 casos de tuberculosis (tasa 27,14/100.000habitantes), mientras que 805 personas fallecieron debido a esta enfermedad (tasa 2,07/100.000 habi-tantes) durante el ao 2006. Aunque las cifras no son necesariamente alarmantes para el lector, llevms de 15 aos reducir a casi la mitad (60/100.000 habitantes en 1990 contra 31/100.000 habitantes en2007) la incidencia de esta enfermedad en nuestro pas. Al mismo tiempo, datos locales de Santa Ferevelan la aparicin de casos de tuberculosis en los cuales las cepas aisladas fueron resistentes amltiples drogas (MDR-TB), definidas como resistentes a las drogas pilares del tratamiento antituberculoso(drogas de primera lnea), isoniacida y rifampicina. Lo preocupante de esta situacin no es lamultirresistencia en s, sino la deteccin en pacientes no tratados previamente, ni encuadrados en lo quese denomina factores de riesgo (institucionalizacin, contacto con familiar enfermo, tratamiento previoabandonado, uso de drogas, entre otros). En definitiva, la batalla sigue y requiere medidas ms rpidasde deteccin y control.

Siendo esta una revista cuya temtica se enfoca en la microbiologa, a esta altura del presente artcu-lo editorial el lector posiblemente se pregunte el porqu de un comentario sobre planes mundiales parael control de la tuberculosis. Hablemos entonces de microbiologa

Recordemos que M. tuberculosis tarda 30 das en formar colonias en medios slidos, por lo que sudeteccin se hace mediante microscopa ptica, y que la sensibilidad de este procedimiento dependedel nmero de bacilos presentes en la muestra. La otra opcin es sembrar la muestra e incubarla hasta60 das, antes de poder informarla como bacteriolgicamente negativa. La determinacin de la sensibi-lidad a drogas de los aislamientos clnicos de M. tuberculosis requiere, de la misma manera, tiemposlargos. Los avances metodolgicos hicieron posible la deteccin y determinacin de la sensibilidad adrogas en plazos ms cortos, de alrededor de 12 das, gracias al empleo de equipos especiales automa-tizados o semiautomatizados (2, 4). Sin embargo son costosos y, por consiguiente, no estn disponiblesen todas las unidades de diagnstico, sino slo en los centros de referencia que, al concentrar muestrasde distintas procedencias, justifican la inversin.

Uno de los temas que requieren la atencin ms urgente es el de la deteccin de cepas MDR. Msan, recientemente se han informado cepas resistentes a drogas de primera y de segunda lnea (1). Enconsecuencia, la escasa cantidad de opciones teraputicas frente a estas cepas deja pocas posibilida-des de tratamiento. En este contexto, los dos objetivos fundamentales en la lucha contra la tuberculosisson la deteccin precoz de la enfermedad y la determinacin de la sensibilidad a drogas lo ms rpidoposible.

La Sociedad Latinoamericana y del Caribe de Tuberculosis y otras Micobacteriosis (SLAMTB) fuefundada en Buenos Aires en setiembre de 2005. Esta institucin es producto de 10 aos de intensacooperacin e intercambio expresados inicialmente a travs de la Red Latinoamericana y del Caribe deTuberculosis (RELACTB) y luego a travs del proyecto de colaboracin financiado por la Unin Europeadenominado Improved Diagnosis, Drug Resistance Detection and Control of Tuberculosis in Latin America.Son parte de esa institucin 50 investigadores de 10 pases de la regin, as como varios procedentesde 4 pases de Europa. Como sociedad abierta ha generado a lo largo de los ltimos aos colaboracio-nes que han sido utilizadas en la implementacin de pasos concretos para el diagnstico de la tubercu-losis humana y animal, y que continan teniendo un alto impacto social y econmico en varios pases.

Editorial 205

Hasta el momento, esta sociedad ha funcionado como satlite de las reuniones anuales o peridicasde la Sociedad Latinoamericana de Microbiologa (ALAM); sin embargo, debido a la especificidad de susobjetivos y a su crecimiento, ha comenzado su actividad en forma independiente. Por ello, luego de tresreuniones previas (Pucn, Chile, 2006; Brasilia, Brasil, 2007 y Bogot, Colombia, 2008) lleg la hora deorganizar nuestra primera reunin independiente en 2009. Esto constituy un gran desafo logstico yeconmico, en el cual fuimos apoyados por la buena voluntad de muchos investigadores de gran pres-tigio internacional, deseosos de incrementar sus colaboraciones con nosotros.

La IV Reunin de la SLAMTB tuvo lugar del 5 al 8 de octubre de este ao en Rosario, y cubri desdeaspectos bsicos como la patogenicidad de las micobacterias, la epidemiologa de la distribucin decepas y su nivel de resistencia a drogas hasta la temtica de las nuevas herramientas de diagnstico ylas drogas para el tratamiento, entre otros tpicos. Adems de los asistentes nacionales, se hicieronpresentes ms de 40 disertantes extranjeros y 80 participantes de Latinoamrica, por lo que esta re-unin se posicion como un evento cientfico de relevancia internacional, con un total de ms de 250asistentes. Es importante destacar que contamos con la presencia de miembros de los servicios dediagnstico microbiolgico de los hospitales de nuestro pas, en especial de Rosario y Buenos Aires, loscuales tuvieron acceso a esta oportunidad nica de participar, aprender y debatir el uso de nuevastcnicas de diagnstico y de determinacin de la sensibilidad a drogas.

Con ese fin decidimos que no hubiera costo de inscripcin ni de asociacin, de modo que fue unareunin de libre acceso. Aunque entendimos las dificultades econmicas presentes en nuestro pas,explicitamos ante distintos sectores pblicos y privados la naturaleza del evento y su gran repercusincientfica y pblica. Si bien este evento increment la transferencia de conocimiento, nos dej en unaposicin financiera vulnerable al no contar con fondos propios.

Sabemos que la baja contribucin de los organismos estatales afect no slo a esta reunin, ya quemuchas otras recibieron fondos insuficientes (del orden de hasta $5.000) o escasos (por debajo de$15.000) (6), girados en su gran mayora con posterioridad al cierre del evento cientfico.

A pesar de la falta de aportes econmicos de los sectores estatales de salud pblica, a los cuales ibadirigida la informacin, la reunin fue un xito acadmico y cientfico que gener elogios por parte detodos los participantes, y se llev a cabo con slo $ 15.000 aportados por el CONICET y algunas contri-buciones realizadas por un puado de empresas locales.

En particular, una de las consecuencias del bajo presupuesto asignado a nuestra reunin fue quevarios estudiantes y profesionales no tuvieron cabida, ya que no se pudo cubrir el costo de salones de lasuficiente capacidad fsica. Sin embargo, entre los puntos que deben destacarse se encuentran la asis-tencia de profesionales de los programas de tuberculosis de distintas provincias argentinas y de pasesvecinos como Paraguay y Bolivia, as como la generosa actitud de investigadores miembros del progra-ma CYTED Programa Iberoamericano de Ciencia y Tecnologa para el Desarrollo del Instituto Pasteurde Francia, y de las Universidades de Alabama en Birmingham, de California San Francisco y de Pittsburgh,EE.UU., que pagaron con fondos propios la mayora de sus gastos de viaje y estada.

El mayor mrito de esta reunin radica en haber transferido informacin relevante para el diagnsticode tuberculosis a personal que, caso contrario, no hubiera tenido acceso a ella, ya que una reuninsimilar en Europa o Estados Unidos tiene un costo promedio de inscripcin de 400 USD. Quizs haya-mos pecado de ingenuos al pensar que obtendramos mayor ayuda de organismos estatales o de insti-tuciones de naturaleza filantrpica.

Desde este lugar y como Presidente del Comit Organizador de la IV Reunin de la SLAMTB, quieroagradecer a todos aquellos que con su ayuda hicieron posible el objetivo de difundir el conocimiento yestimular las interacciones entre los distintos grupos de ciencia bsica y de diagnstico. Sin embargo,cabe citar una de las frases dichas por el Dr. Manuel Carrillo: Solo sirven las conquistas cientficassobre la salud si stas son accesibles al pueblo (7). Al respecto, quisiera agregar que para que esto

206 Revista Argentina de Microbiologa (2009) 41: 203-206

suceda, primero deben hallar su camino desde el laboratorio donde se desarrollaron las tcnicas (lasconquistas) hasta los servicios que masificarn su uso en pos del bienestar de la comunidad. Slo unapoyo econmico adecuado por parte del Estado a las reuniones cientficas permitir que las innovacio-nes tecnolgicas y cientficas puedan ser aprovechadas para mejorar la salud y la calidad de vida de laspersonas.

HCTOR RICARDO MORBIDONICtedra de Microbiologa, Virologa y Parasitologa

Facultad de Ciencias MdicasUniversidad Nacional de Rosario, Argentina.

E-mail: morbiatny@yahoo.com

1. Abubakar I, Moore J, Drobniewski F, Kruijshaar M, BrownT, Yates M, et al Extensively drug-resistant tuberculosis inthe UK: 1995 to 2007. Thorax 2009; 64: 512-5.

2. Lin SY, Desmond E, Bonato D, Gross W, Siddiqi SJ.Multicenter evaluation of Bactec MGIT 960 system forsecond-line drug susceptibility testing of Mycobacterium tu-berculosis complex. J Clin Microbiol 2009; 47: 3630-4.

3. Organizacin Mundial de la Salud 2009. Global tuberculosiscontrol: epidemiology, strategy, financing. WHO report 2009.

4. Roberts GD, Goodman NL, Heifets L, Larsh HW, LindnerTH, McClatchy JK, et al. Evaluation of the BACTEC

radiometric method for recovery of mycobacteria and drugsusceptibility testing of Mycobacterium tuberculosis fromacid-fast smear-positive specimens. J Clin Microbiol 1983;18: 689-96.

5. Smith, I. En Frieden, T, editor. Tuberculosis: deteccin decasos, tratamiento y vigilancia: preguntas y respuestas: (Pu-blicacin Cientfica y Tcnica No. 617. OPS) Kurt Toman.2 ed. Washington, D.C., 2006.

6. ht tp: / /www.agencia.gov.ar / IMG/pdf /RC_l is tado_reuniones_financiadas.pdf

7. http:///www.lagazeta.com.ar/carrillo.htm

Genome amplification of Influenza virus 207ISSN 0325-7541Revista Argentina de Microbiologa (2009) 41: 207-211INFORME BREVE

Complete genome amplification of Equineinfluenza virus subtype 2

G. H. SGUAZZA1*, N. A. FUENTEALBA1, 2, M. A. TIZZANO1, 3, C. M. GALOSI1, 3, M. R. PECORARO1.

1Ctedra de Virologa, Facultad de Ciencias Veterinarias, Universidad Nacional de La Plata;2Consejo Nacional de Investigaciones Cientficas y Tcnicas (CONICET); 3Comisin de Investigaciones Cientficas de la

Provincia de Buenos Aires (CIC), Argentina.*Correspondence. E-mail: sguazza@fcv.unlp.edu.ar

ABSTRACTThis work reports a method for rapid amplification of the complete genome of equine influenza virus subtype 2 (H3N8).A ThermoScriptTM reverse transcriptase instead of the avian myeloblastosis virus reverse transcriptase or Moloneymurine leukemia virus reverse transcriptase was used. This enzyme has demonstrated higher thermal stability and isdescribed as suitable to make long cDNA with a complex secondary structure. The product obtained by this methodcan be cloned, used in later sequencing reactions or nested-PCR with the purpose of achieving a rapid diagnosis andcharacterization of the equine influenza virus type A. This detection assay might be a valuable tool for diagnosis andscreening of field samples as well as for conducting molecular studies.

Key words: Equine influenza virus, genome, diagnosis, RT-PCR

RESUMENAmplificacin del genoma completo del subtipo 2 del virus de la influenza equina. En este trabajo comunicamosun mtodo rpido que permite la amplificacin del genoma completo del subtipo 2 (H3N8) del virus de la influenzaequina. Se utiliz la enzima transcriptasa reversa ThermoScriptTM en lugar de la transcriptasa reversa del virus de lamieloblastosis aviar o la transcriptasa reversa del virus de la leucemia murina de Moloney. Esta enzima ha demostradotener una alta estabilidad trmica y la capacidad de hacer largas copias de ADN con una estructura secundariacompleja. El producto obtenido por esta tcnica puede ser clonado y utilizado posteriormente en reacciones desecuenciacin o de PCR anidada con la finalidad de lograr un diagnstico rpido y la caracterizacin del virus de lainfluenza equina tipo A. Este ensayo de deteccin puede llegar a ser una valiosa herramienta para el diagnstico y elanlisis de muestras de campo, as como para la realizacin de estudios moleculares.

Palabras clave: Virus de la influenza equina, Genoma, Diagnstico, RT-PCR

Ctedra de Virologa, Facultad de Ciencias Veterinarias, Universidad Na-cional de La Plata 60 & 118, La Plata, CP 1900, Buenos Aires, ArgentinaTelephone and fax number: 54 221 4257980

Influenza viruses belong to the Orthomyxoviridae familyand are classified into three great types: A, B, and C,according to antigenic differences in their nucleoprotein(NP) and matrix (M) proteins. Influenza viruses types Band C are predominantly human pathogens that have alsobeen isolated from seals and pigs, respectively. On theother hand influenza viruses type A have been isolatedfrom many species including humans, pigs, horses, mar-ine mammals and a wide range of domestic and wild birds(10). Influenza viruses type A can be further subdiv-ided in different serologically differentiated subtypesaccording to the structure and composition of two antigenicglycoproteins located in the surface of the virion: haemag-glutinin (HA) involved in binding of the virus to host cellsand neuraminidase (NA) implicated in release of virus

from infected cells. At present, 16 HA and 9 NA subtypeshave been identified among influenza A viruses. All thesesubtypes are found in avian species. However, only twoequine influenza virus subtypes have been associatedwith the disease in horses, the H7N7 subtype (equi-1)and the H3N8 subtype (equi-2). The H7N7 subtype wasfirst isolated from horses in Czechoslovakia in 1956 (pro-totype strain: A/equine1/Prague/56); later it was isolatedin many countries of Europe and America. Although thissubtype has not been isolated since 1980, it may still cir-culate in subclinical form and persist at very low levels insome parts of the world (10). The H3N8 subtype of equineinfluenza virus was first isolated in 1963 during an out-break of this disease in Miami (prototype strain: A/equine2/Miami/63) and can be found in different parts of the world,except in Australia, New Zealand, and Iceland. Recentstudies of the H3N8 subtype of equine influenza viruseshave demonstrated that these strains have diverged intotwo distinct evolutionary lineages (2).

208 Revista Argentina de Microbiologa (2009) 41: 207-211

The genome of equine influenza A virus contains eightlinear segments of negative stranded RNA (about 13.6kb). Six segments code for single proteins: the three viralpolymerases (PA, PB1 and PB2), HA, NA and NP. Theother two segments codify two proteins, one segment formatrix 1 and 2 (M1 and M2) and the other segment fornon-structural protein 1 (NS1) and nuclear export protein(NEP) (5).

The analysis of virion RNA from influenza A strainsindicates that all eight RNA segments contain a commonsequence of 13 nucleotides at the 3' terminus and an-other common sequence of 12 nucleotides at the 5' ter-minus (3, 9). No homologies can be found among seg-ments. On these bases, the aim of this work was to de-velop a rapid method that allows the genetic characteriz-ation of the whole genome of influenza virus using a proce-dure of reverse transcription followed by the amplificationof all viral segments through polymerase chain reaction(RT-PCR).

The standard method for diagnosis of influenza is theisolation of influenza virus particles using embryonatedchicken eggs or Madin-Darby canine kidney cells (MDCK).This system has the disadvantage of requiring 4-6 daysfor completion. The complete genome amplification byRT-PCR reported in this paper followed by subsequentamplicon sequencing is a more versatile method becauseit allows obtaining more detailed information about circul-ating strains and it will help in the virus surveillance.

To amplify the influenza virus genome, two primersbased on the highly conserved non-coding sequences atthe 5 and 3 end present in all viral genomic segments ofinfluenza A virus were used, according to the consensussequence regions previously reported (3, 9) and widelyused to amplify the complete genome of human and avianinfluenza A virus (4) and equine influenza A virus subtype1 (1). To confirm the presence of those conserved regionsin the genome of equine influenza subtype 2, 50 differentsequences of all segments from the viral genome retrievedfrom the GenBank at the National Center of Biotechnol-ogy Information (http://www.ncbi.nlm.nih.gov) were com-pared by multiple alignment using the CLUSTAL X (v1.8)software.

The consensus regions were identified as suitablesequences for use as primers in RT-PCR, and the oligo-nucleotide primers were subsequently commercially syn-thesized (Integrated DNA Technologies, Coralville, IA,USA). The primers used in this work were a 12-mer primerUFLU-S 5AGCAAAAGCAGG 3 and a 13-mer primerUFLU-AS 5AGTAGAAACAAGG 3 (Fig. 1).

An equine influenza virus strain, A/Equine-2/La Plata/2001 (H3N8), previously isolated in our laboratory duringthe year 2001, was used. The virus was propagated inthe allantoic cavity of 11-day-old embryonated hens eggsderived from a healthy flock.

Total RNA was extracted using Trizol reagent (GIBCOBRL, Gaithersburg, MD, USA). In brief, 500 l of allantoic

Figure 1. Alignment of non-coding terminal regions of the eight segments of Influenza A virus (A/equine-2/Kentucky/5/02. GenBankaccession numbers AY855340, AY855339, AY855338, AY855341, AY855342, AY855343, AY855344 and AY855345 respectively).The 5 terminus of each segment has 12 conserved nucleotides (A), and the 3 terminus has 13 conserved nucleotides (B).

Genome amplification of Influenza virus 209

fluid (haemagglutination titre 1:128) were mixed with 500l of Trizol reagent. The mixture was extracted with 220l of chloroform. After centrifugation at 10000 x g for 10minutes, the RNA in the aqueous solution was precipitatedby adding an equal volume of isopropanol. The precipi-tated RNA was collected by centrifugation at 10000 x gfor 20 minutes, washed by 70% ethanol, dissolved in 50l of RNAse-free water and measured by spectrophotom-eter (SmartSpec 3000, BIO-RAD, Hercules, CA, USA).RNA extracted from uninfected allantoic fluid was usedas negative control. Total RNA and control RNA (375.06ng/l and 225.52 ng/l respectively) were used for fol-lowing steps.

One microgram of each RNA was used to produce asingle-strand copy of DNA (ssDNA). This reaction wascarried out using the avian myeloblastosis virus (AMV)reverse transcriptase (Promega Corporation, Madison,WI, USA), the Moloney murine leukemia virus (M-MMLV)reverse transcriptase (Promega) and the ThermoScriptRT-PCR System kit (Invitrogen-Life Technologies, Bue-nos Aires, Argentina) under conditions specified by thesuppliers, using a concentration 0.5 M of the universalprimer complementary to the conserved 3 end of allvirus segments (UFLU-S).

The single-strand DNA (ssDNA) obtained with AMV,M-MLV and RT-ThermoScript was used directly as tem-plate in the PCR reaction whereas the cDNA generatedby RT-ThermoScript was additionally employed for mak-ing a double-strand DNA copy (dsDNA) in agreement withthe suppliers suggestion.

The second chain of DNA was synthesized using 3 lof ssDNA previously obtained (approximately 100 ng) ina reaction mixture containing: 75 mM Tris-HCl (pH 8.8),20 mM (NH4)2SO4, 0.01% Tween 20, 200 M of eachdNTPs, 1.5 mM of MgCl2 and 0.5 M of UFLU-AS primerin a final volume of 24.5 l. The mixture was incubated at95 C during 4 minutes, followed by the addition of 0.5 l(2.5 U) of Taq DNA polymerase (Fermentas Inc, GlenBurnie, MD, USA) and it was incubated at 65 C during20 minutes.

The PCR reaction was performed by adding 5 l fromthe ssDNA or dsDNA to a reaction mixture containing afinal concentration of 75 mM Tris-HCl (pH 8.8), 20 mM(NH4)2SO4, 0.01% Tween 20, 200 M of each one ofdNTPs, 0.5 M of each one of primers (UFLU-S andUFLU-AS), a variable concentration of MgCl2 (1, 1.5, 2and 2.5 mM) and variable percentages of dimethil sulfoxide(0, 5 and 10% of DMSO) in a final volume of 49.5 l.

The mixture was heated at 95C during 4 minutes andincubated with variable annealing temperatures (38, 40,42 and 44 C) for 2 minutes, then 0.5 l (2.5 U) from TaqDNA polymerase (Fermentas) were added. The amplificationprogram started with 1 cycle at 65 C for 10 minutes, fol-lowed by 40 cycles at 92 C for 2 minutes, the same an-nealing temperature initially used for 2 minutes, and 65 C

for 10 minutes; the program ended with one cycle at 72 Cfor 10 minutes. The PCR product was run on agarose gel(1.5%) at 50 V during 6 hours, and the gel was stainedwith ethidium bromide and visualized with a UV transillu-minator.

To evaluate the efficiency among reverse transcrip-tases AMV, M-MLV and ThermoScript, a protocol wasused to amplify the whole genome of equine influenzavirus. Improved results were observed when using dsDNAgenerated by ThermoScript-RT. When the ssDNA templateobtained from AMV, M-MLV and ThermoScript was used,only a few bands could be observed in agarose gel (Fig. 2)corresponding to small size fragments of the genome.

The optimum PCR reaction was obtained by adding 5l from the dsDNA to a reaction mixture containing a finalconcentration of 75 mM Tris-HCl (pH 8.8), 20 mM(NH4)2SO4, 0.01% Tween 20, 200 M of each dNTP, 1.5M of MgCl2, 0.5 M of each primer, 10% of DMSO and2.5 U of Taq DNA polymerase.

An improved PCR amplification was carried out byheating the PCR mixture at 95 C during 4 minutes, an-

Figure 2. RT-PCR using ssDNA as template: Lanes 3, 4 and 6:amplicon obtained from AMV, M-MLV and RT-ThermoScript;Lanes 1, 2 and 7: negative controls (RNA from uninfected allantoicfluid) obtained from AMV, M-MLV and ThermoScript RT,respectively. Lane 5: molecular size marker ( EcoRI-HindIIIMarker - Promega).

210 Revista Argentina de Microbiologa (2009) 41: 207-211

Figure 3. RT-PCR using dsDNA as template: Lane 1: molecularsize marker ( EcoRI-HindIII Marker - Promega); Lane 2: RT-PCR product.

nealing at 40 C for 2 minutes and then adding 0.5 l (2.5U) from Taq DNA polymerase (Fermentas). The amplifi-cation program started with 1 cycle at 65 C for 10 min-utes, followed by 40 cycles at 92 C for 2 minutes, 40 Cfor 2 minutes, and 65 C for 10 minutes and a final exten-sion at 72 C for 10 minutes

The eight segments of equine influenza subtype 2 wereamplified simultaneously using primers UFLU-S andUFLU-AS (Fig. 3). No amplified DNA was observed fromthe RNA negative control. Bands corresponding to basicpolymerases (PB2 and PB1, segments 1 and 2 respec-tively) could not be clearly differentiated from each otherbecause they were the same size (2341 bp each). It wasfollowed by a band belonging to the acid polymerase (PA)

of 2233 bp, segment 4 (HA) with 1778 bp, segment 5(NP) of 1565 bp, segment 6 (NA) with 1413 bp, segment7 (M) of 1027 bp and, at the end, a band belonging tosegment 8 (NS) which showed an increased PCR prod-uct amount probably due to its smaller size.

In this study, the amplification conditions for the com-plete EIV genome were improved. The data presented inthis paper demonstrate that this method could be a help-ful tool in the surveillance of the equine influenza virusand appropriate for cloning the eight genomic segments,which will facilitate large-scale EIV genome sequencingand greatly ease systematic genetic analyses of thevirus. Adeyefa et al. (1) have described a multiplex RT-PCR method in which 12-mer and 13-mer oligonucleotidescomplementary to the conserved regions were used,resulting in simultaneous amplification of all of the eightRNA segments of Equine Influenza virus subtype 1. Inthis work, a ThermoScript RT instead of AMV or M-MLVRT was used to amplify the full length genome of equineinfluenza virus subtype 2 (H3N8). This enzyme has higherthermal stability and is described as suitable to make longcDNA with complex secondary structure.

The product obtained by this method can be clonedand used in later sequencing reactions or nested-PCRwith the purpose of achieving a rapid diagnosis and char-acterization of the equine influenza virus type A (1, 8).

This test is much faster than the isolation of the virusfrom nasopharyngeal swabs/washings using embryonatedeggs or cell cultures and the possibility of automation willallow handling a large number of clinical samples moreconveniently than with serological tests (7, 8).

RT-PCR might be useful in detecting inapparent, sub-clinical infection in animals that contribute to the spreadof the virus. Accurate identification of infected animalsand inapparent carriers is essential for the control of thisdisease.

REFERENCES

1. Adeyefa CA, Quayle K, McCauley JW. A rapid method forthe analysis of influenza virus genes: application to thereassortment of equine influenza virus genes. Virus Res1994; 32: 391-9.

2. Daly JM, Lai AC, Binns MM, Chambers TM, BarrandeguyM, Mumford JA. Antigenic and genetic evolution of equineH3N8 influenza A viruses. J Gen Virol 1996; 77: 661-71.

3. Desselberger U, Racaniello VR, Zazra JJ, Palese P. The 3and 5-terminal sequences of influenza A, B and C virusRNA segments are highly conserved and show partialinverted complementarity. Gene 1980; 8: 315-28.

4. Hoffmann E, Stech J, Guan Y, Webster RG, Perez DR.Universal primer set for the full-length amplification of allinfluenza A viruses. Arch Virol 2001; 146: 2275-89.

5. McCauley JW, Mahy BW. Structure and function of the in-fluenza virus genome. Biochem J 1983; 211: 281-94.

Genome amplification of Influenza virus 211

Recibido: 28/04/09 Aceptado: 22/09/09

6. Oxburgh L, Klingeborn B. Cocirculation of two distinctlineages of equine influenza virus subtype H3N8. J ClinMicrobiol 1999; 37: 3005-9.

7. Oxburgh L, Hagstrm A. A PCR based method for theidentification of equine influenza virus from clinical samples.Vet Microbiol 1999; 67: 161-74.

8. Quinlivan M, Cullinane A, Nelly M, Van Maanen K, HeldensJ, Arkins S. Comparison of sensitivities of virus isolation,

antigen detection, and nucleic acid amplification for detectionof equine influenza virus. J Clin Microbiol 2004; 42: 759-63.

9. Skehel JJ, Hay AJ. Nucleotide sequences at the 5' terminiof influenza virus RNAs and their transcripts. Nucleic AcidsRes 1978; 5: 1207-19.

10. Webster RG, Bean WJ, Gorman OT, Chambers TM,Kawaoka Y. Evolution and ecology of influenza A viruses.Microbiol Rev 1992; 56: 152-79.

212 Revista Argentina de Microbiologa (2009) 41: 212-214ISSN 0325-7541Revista Argentina de Microbiologa (2009) 41: 212-214INFORME BREVE

Brote de micoplasmosis clnica por Mycoplasma ovis enovinos de Salta, Argentina. Diagnstico clnico,

microbiolgico y molecularD. H. AGUIRRE*1, C. THOMPSON2, R. D. NEUMANN1, A. O. SALATIN1, A. B. GAIDO1,

S. TORIONI de ECHAIDE2

1Estacin Experimental Agropecuaria Salta, CC 228 (4400) Salta, 2Estacin Experimental Agropecuaria Rafaela,(2300) Rafaela, Santa Fe; Instituto Nacional de Tecnologa Agropecuaria, Argentina.

*Correspondencia. E-mail: daguirre@correo.inta.gov.ar

RESUMENMycoplasma ovis es un parsito obligado de los eritrocitos de los pequeos rumiantes (ovinos, caprinos), en los queproduce anemia crnica o aguda. Su distribucin es mundial, aunque se desconoce la difusin de esta bacteria en laArgentina. Este trabajo describe un brote de micoplasmosis en un rebao ovino de la localidad saltea de Rosario dela Frontera, ocurrido en enero de 2007. Durante ese brote result afectada la categora de ovinos adultos, con unamortalidad del 17,8%. El diagnstico en extendidos de sangre (tincin de Giemsa) revel pequeos cuerpos basfilos,caractersticos de la infeccin por M. ovis, en todas las muestras examinadas (n = 11), lo que indica una alta preva-lencia de la infeccin en la majada. El diagnstico molecular (n = 9) confirm los hallazgos mediante la amplificacinde dos fragmentos del gen 16S rRNA. Este representa el tercer registro del microorganismo en la Argentina y elprimero con expresin clnica a escala poblacional (rebao).Palabras clave: Mycoplasma ovis, ovinos, brote, Argentina

ABSTRACTClinical mycoplasmosis outbreak due to Mycoplasma ovis in sheep from Salta, Argentina. Clinical,microbiological and molecular diagnosis. Mycoplasma ovis is an obligatory parasite of the erythrocytes from smallruminants (sheep, goat), wherein it causes chronic or acute anaemia. This agent shows worldwide distribution. However,its dispersion is still unknown in Argentina. This work describes an outbreak of mycoplasmosis occurred in January2007 in a sheep flock from Rosario de la Frontera, Salta, Argentina. Adult sheep became ill with a mortality rate of17.8%. All blood smears (n = 11) examined by Giemsa stain showed the presence of small basophile bodies characteristicof M. ovis infection, indicating a high prevalence of the infection in the flock. The molecular diagnosis (n = 9) confirmedthe findings through the amplification of two fragments from the 16S rRNA gene. This is the third report of M. ovis inArgentina and the first one concomitant with clinical signs at flock level.

Key words: Mycoplasma ovis, sheep, outbreak, Argentina

Mycoplasma ovis, hasta hace poco Eperythrozoon ovis,es una bacteria pleomrfica y un parsito obligado de loshemates de ovinos y caprinos, no cultivable en mediosartificiales. Hoy integra el grupo de micoplasmas conocidocomo hemoplasmas, con rasgos patognicos antes noconsiderados entre los Mollicutes (8, 9). Este agente fuedescrito en 1934 por Neitz et al. (10) en Sudfrica, y des-de entonces se lo diagnostic en todo el mundo (8, 9). EnArgentina, las nicas referencias previas de M. ovis co-rresponden a las regiones Noreste, provincia de Corrien-tes (15), y Noroeste, provincia de Salta (1).

Esta bacteria se transmite por artrpodos hema-tfagos y por fmites. Hasta ahora son pocas las espe-cies de vectores comprobadas, que comprenden garra-patas (Haemaphysalis plumbeum y Rhipicephalus bursa)

y mosquitos (Aedes camptorhynchus y Culex annulirostris)(9). Mycoplasma ovis se puede trasmitir tambin de ma-nera artificial por el uso de instrumental comn en distin-tas prcticas ganaderas, como vacunaciones, esquila oaplicacin de caravanas (2, 8).

La infeccin por M. ovis es generalmente asintomtica,aunque se han descrito cuadros clnicos de curso crni-co y agudo. La forma crnica se caracteriza por anemiamoderada, fatiga y menor produccin de carne y lana (3,4). En animales portadores, la anemia puede eventual-mente acentuarse por estrs, inmunosupresin o enfer-medades concurrentes (8). La forma aguda cursa confiebre, anemia grave, ictericia, depresin, prdida de pesoy muerte (12, 13). Los ovinos infectados mantienen elagente durante perodos prolongados (2, 5, 11), aun des-

Brote de micoplasmosis clnica por Mycoplasma ovis en ovinos 213

pus de la terapia con antibiticos eficaces (8, 9). Con lacoloracin de Giemsa, M. ovis se observa en la superfi-cie de los eritrocitos como pequeos organismos basfiloscocoides de 0,5 a 1,0 m de dimetro (9). El gen 16SrRNA ha sido usado como marcador para la caracteriza-cin molecular y en estudios taxonmicos de Mycoplasmaspp. en diferentes hospedadores (6, 8, 9).

Este trabajo informa sobre los aspectos epidemiol-gicos, clnicos y mtodos de diagnstico empleados enun brote de micoplasmosis ovina ocurrido en cercanasde Rosario de la Frontera (2548S, 6458O), Salta, enuna pequea majada integrada poco antes por ovinosde origen local diverso. El rebao se compona de 39animales, 28 adultos y 11 cras de hasta dos meses deedad. Alrededor de un mes antes del primer deceso, lamajada haba sido vacunada contra clostridiosis ydesparasitada con ivermectina va inyectable. El rebaosoportaba una elevada incidencia de insectos hemat-fagos (especies no determinadas) al momento del brote.

En enero de 2007 murieron cinco animales adultos(17,8%), uno el da 5, otro el 16, dos el 17 y uno el 18. Elda 19 se efectuaron las necropsias de dos ovejas muer-tas. Con sangre de una de ellas se realizaron extendidosfinos y gruesos, los que se colorearon con Giemsa al10% y se examinaron al microscopio con objetivo de in-mersin (100X) para detectar la presencia de hemopa-rsitos.

Los das 19, 21 y 23 de enero todos los ovinos reci-bieron tratamientos con tetraciclina inyectable (Oxiton,Agropharma, Argentina) en dosis de 5 mg/kg. En los dassiguientes no ocurrieron nuevos decesos. El 26 de enerose realizaron extendidos de sangre perifrica (oreja) y seobtuvieron muestras de sangre con anticoagulantes(EDTA, citrato de sodio al 5%) de 10 ovinos adultos delrebao. Los extendidos se procesaron y examinaroncomo antes se refiri. Las muestras con EDTA se utiliza-ron para determinar el ndice hematocrito mediante latcnica del microhematocrito, mientras que las muestrascitratadas se emplearon para conocer la identidadgenmica de Mycoplasma spp. por la tcnica de la reac-cin en cadena de la polimerasa (PCR) y el anlisis de lasecuencia del producto amplificado.

Para realizar la PCR se utilizaron los oligonucletidos340F y 543R, previamente descritos (9), y otros disea-dos ad hoc (Myc783F AGTAGTCCACGCCGTAAACGATy Myc764R TCAGTTATATCCCAGGTACTCGCC) a partirde la secuencia del gen 16S rRNA de M. ovis de referen-cia (AF338268). Los productos amplificados se purifica-ron (Qiagen) y se enviaron a secuenciar. Las secuenciasresultantes se alinearon mediante el programa informticoBioedit y se compararon con la secuencia de referenciade M. ovis y de Mycoplasma wenyonii (AF016546) (9). Losanlisis filogenticos se realizaron mediante el programaMega 4 utilizando el mtodo Neighbor-joining (correccinde Kimura-2 parmetros) (14).

Las necropsias mostraron alteraciones similares enambas ovejas: anemia, ligera ictericia subcutnea, mar-cada ictericia heptica, esplenomegalia, riones friablesy congestin y edema pulmonares. El estado nutricionalde los animales era ptimo, segn reflejaban gruesosdepsitos adiposos abdominales. En ninguna de las ove-jas se hallaron nematodes abomasales (i.e. Haemonchuscontortus), a menudo responsables de mortalidad estivo-otoal por anemia en los ovinos de la regin. Tampocose observaron ectoparsitos (melfagos, piojos o garra-patas) fijados a la piel o lana de las ovejas.

La sangre de una de las ovejas muertas revel al exa-men microscpico mltiples cuerpos basfilos adheridosa los eritrocitos, acordes con las descripciones de M. ovis.Cuerpos idnticos se observaron tambin, en menor n-mero, en todos los extendidos de sangre obtenidos delos ovinos sobrevivientes (Figura 2). En ningn caso losextendidos mostraron cambios significativos del cuadrohemtico (reticulocitosis, anisocitosis, etc.). La media delndice de hematocrito de los 10 ovinos muestreados fuede 33,0 (rango 24-37).

En nueve de las nueve muestras analizadas se logra-ron amplificar dos fragmentos del gen 16S rRNA, uno de224 pb con los oligonucletidos Myc340F-Myc543R y otrode 417 pb con los oligonucletidos Myc340F-Myc764R.Slo tres secuencias del gen 16S rRNA resultaron legiblese idnticas entre s y fueron depositadas en el GenBank(N de acceso FJ866785). Ambas mostraron un 98% desimilitud, tanto con la secuencia de M. ovis (AF338268)como con la de M. wenyonii (AF016546). La Figura 1presenta un rbol filogentico con la relacin entre estasltimas dos secuencias y los tres fragmentos secuen-ciados. Estos resultados confirman la gran similitud en-tre M. ovis y M. wenyonii, previamente observada porotros autores, tanto inmunolgica (7) como filogentica(9). Como M. wenyonii es considerado especfico de los

Figura 1. rbol filogentico obtenido mediante un anlisis deNeighbor-joining (Kimura-2 parmetros) a partir del alineamien-to de las secuencias de referencia de M. ovis y M. wenyonii.Acholeplasma laidlawii fue usado como grupo externo. En losnodos del rbol se aclara el valor obtenido en la prueba estads-tica de bootstrap (1000 repeticiones). El anlisis se efectu conel programa informtico Mega 4. Entre parntesis se muestra elnmero de acceso a GenBank de cada secuencia. Las nuevassecuencias obtenidas fueron depositadas en el GenBank (N deacceso FJ866785).

0

0

0

0RYLV$)

0ZHQ\RQLL$)

$ODLGODZLL0

76

99

0.005

214 Revista Argentina de Microbiologa (2009) 41: 212-214

bovinos (8), la hiptesis de una eventual infeccin de losovinos con este agente se estima improbable.

Los cambios anatomopatolgicos sumados a laanamnesis y al diagnstico microscpico y molecularprueban la accin patgena de M. ovis en el caso aqureferido. Esta bacteria se diagnostica de rutina por elexamen directo de extendidos de sangre coloreados, sibien la baja parasitemia de las infecciones crnicas pue-de conducir a resultados falso negativos. El diagnsticodefinitivo requiere entonces la inoculacin de sangre deanimales sospechosos en ovinos o caprinos esplenec-tomizados, o bien el empleo de tcnicas de biologamolecular, como la utilizada en esta investigacin (8).

Es probable que la tasa de mortalidad de este brotede micoplasmosis hubiese sido mayor en ausencia delas medidas teraputicas aplicadas. La mortalidad secircunscribi a ovinos adultos, como hace poco ocurrien un rebao de Hungra, donde muri el 5,5% de lasovejas adultas (6). La prevalencia de la infeccin fue muyelevada, ya que el 100% de los ovinos muestreados (n =11) exhibieron presencia de M. ovis. La transmisin pudoverse favorecida por la abundancia de insectos hema-tfagos o por iatrogenia asociada a medicaciones inyec-tables administradas con anterioridad en el rebao.

El presente brote result curioso dados los escasosprecedentes sobre esta infeccin. Aunque se postula quela distribucin de M. ovis es amplia en las reas del norte

argentino con abundancia de vectores (15), la primerasospecha de su relevancia patgena a nivel local surgihace poco, tras la muerte de un carnero trasladado deCrdoba a Salta (1). Pero ese caso aislado no permitimayores inferencias sobre el origen de la infeccin porM. ovis y su patogenicidad. Por el contrario, el brote enovinos nativos de Salta que aqu se describe confirma lapresencia regional del agente y aporta evidencia contun-dente de su accin deletrea a escala poblacional, la quedesde ahora deber contemplarse para el diagnsticonosolgico diferencial.

BIBLIOGRAFA

1. Aguirre D, Cafrune M, Arjona C, Venzano A. Micoplasmosis(eperythrozoonosis) ovina en Salta, Argentina. XVII Con-greso Latinoamericano de Parasitologa, Resumen 187.Parasitol Latinoam 2005; 60: 173.

2. Brun-Hansen H, Gronstol H, Waldeland H, Hoff B.Eperythrozoon ovis infection in a commercial flock of sheep.Zentbl Veterinarmed B 1997; 44: 295-9.

3. Burroughs GW. The significance of Eperythrozoon ovis inill-thrift in sheep in the eastern Cape coastal areas of SouthAfrica. J S Afr Vet Assoc 1988; 59: 195-9.

4. Daddow KN. Eperythrozoon ovis a cause of anaemia,reduced production and decreased exercise tolerance insheep. Aust Vet J 1979; 55: 605-6.

5. Daddow KN. The duration of the carrier state ofEperythrozoon ovis infection in sheep (letter). Aust Vet J1981; 57: 49.

6. Hornok S, Meli ML, Erdos A, Hajts I, Lutz H, Hofmann-Lehmann R. Molecular characterization of two differentstrains of haemotropic mycoplasmas from a sheep flockwith fatal haemolytic anaemia and concomitant Anaplasmaovis. Vet Microbiol 2009; 136: 372-7.

7. Kreier JP, Ristic M. Morphologic, antigenic and pathogeniccharacteristics of Eperythrozoon ovis and Eperythrozoonwenyoni. Am J Vet Res 1963; 24: 488-500.

8. Messick JB. Hemotropic mycoplasmas (hemoplasmas): areview and new insights into pathogenic potential. Vet ClinPathol 2004; 33: 2-13.

9. Neimark H, Hoff B, Ganter M. Mycoplasma ovis comb. nov.(formerly Eperythrozoon ovis), an epierythrocytic agent ofhaemolytic anaemia in sheep and goats. Int J Syst EvolMicrobiol 2004; 54: 365-71.

10. Neitz WO, Alexander RA, Du Toit PJ. Eperythrozoon ovis(sp. nov.) infection in sheep. Onderstepoort J Vet Sci 1934;3: 263-9.

11. Overas J. Studies on Eperythrozoon ovis infection insheep. Acta Vet Scand 1969; Suppl 28: 1-148.

12. Rouse BT, Johnson RH. Eperythrozoon ovis. Vet Rec 1966;79: 223-4.

13. Sheriff D, Clapp KH, Reid MA. Eperythrozoon ovis infectionin South Australia. Aust Vet J 1966; 42: 169-76.

14. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: MolecularEvolutionary Genetics Analysis (MEGA) software version4.0. Mol Biol Evol 2007; 24: 1596-9.

15. Vanzini VR, Somma de Fere GR, Zurbriggen MA, HomseAC, Draghi de Bentez MG, Rochinotti D, et al. Hallazgo deEperythrozoon ovis en la provincia de Corrientes (Argenti-na). IDIA 1983; 417- 420: 105-7.

Figura 2. Extendido de sangre ovina. Glbulos rojos con pre-sencia de formas cocoides sobre su superficie (flechas), com-patibles con Mycoplasma ovis. Coloracin de Giemsa. 1000 x

Recibido: 21/04/09 Aceptado: 28/07/09

Spoligotyping of Mycobacterium bovis isolates from cats 215ISSN 0325-7541Revista Argentina de Microbiologa (2009) 41: 215-217ARTCULO ORIGINAL

Mycobacterium bovis in Argentina: isolates from catstypified by spoligotyping

M. J. ZUMRRAGA1*, M. MARTNEZ VIVOT 2, D. MARTICORENA2, A. BERNARDELLI 3,R. FASN4, R. IACHINI 5, A. A. CATALDI 1.

1Instituto de Biotecnologa, CICVyA-INTA, Castelar; 2Facultad de Veterinaria, Universidad de Buenos Aires;3Ctedra de Patologa de la Universidad Nacional de Ro IV, Crdoba; 4LACLIVET, Buenos Aires;

5Instituto Pasteur, Buenos Aires, Argentina.*Correspondence. E-mail: mzumarraga@cnia.inta.gov.ar

ABSTRACTIn the present work, 19 Mycobacterium bovis isolates from different cats were typified by spoligotyping. We detectednine spoligotypes. There was only one cluster, which grouped 11 of the isolates (57.9%), showing the main spoligotypefrom cattle from Argentina. The rest of the spoligotypes presented only one isolate each. Five of them were not foundin cattle, and were unique and exclusive of cats. The isolates studied show that tuberculosis of bovine origin in catsconstitutes a potential public health problem in Buenos Aires region. The identification of genotypes from non-naturalhosts could contribute to understand the spread of bovine tuberculosis. This is the first report showing genetic profilesof M. bovis isolates in felines from Argentina.

Key words: tuberculosis, cats, spoligotyping

RESUMENMycobacterium bovis en Argentina: aislamientos de gatos tipificados por spoligotyping. En el presente trabajose tipificaron por spoligotyping 19 aislamientos de M. bovis de diferentes gatos. Se detectaron 9 espoligotipos y unnico agrupamiento o cluster integrado por 11 aislamientos (57,9%) y relacionado con el principal espoligotipo debovinos de Argentina. El resto de los espoligotipos detectados presentaron solamente un aislamiento cada uno; 5 deellos no se encontraron en bovinos y fueron nicos y exclusivos de gatos. La presencia de estos aislamientos indicaque la tuberculosis bovina en los gatos constituye un potencial problema de salud pblica en la ciudad de BuenosAires. La identificacin de genotipos de aislamientos de M. bovis de hospedadores no convencionales podra contri-buir a la mejor comprensin de la diseminacin de la tuberculosis bovina. Este es el primer informe en el que semuestran los perfiles genotpicos de aislamientos de M. bovis obtenidos de felinos de Argentina.

Palabras clave: tuberculosis, gatos, spoligotyping

INTRODUCTION

Bovine tuberculosis is a chronic zoonosis that affectsdifferent wild and domestic animals, causing relevanteconomic losses in livestock. The causative agent isMycobacterium bovis, a member of the Mycobacteriumtuberculosis complex, which also includes Mycobacteriumtuberculosis, Mycobacterium africanum, Mycobacteriummicroti, Mycobacterium canetti, Mycobacterium capraeand Mycobacterium pinnipedii (4). The main host of M.bovis is cattle, although several mammalian species canalso be infected. In Argentina, the prevalence in cattle isaround 1.2%, estimated by detection of lesions in theslaughterhouse (13). Among domestic animals, cats arethe most susceptible hosts of bovine tuberculosis (14).

The main pathway of tuberculosis infection in felinesis the digestive route. However, tuberculosis can alsoinfect by the aerogenic pathway and/or injured scratches.

Cats are more susceptible to M. bovis than dogs,probably because a common pet owners habit is to feed

cats only with raw food such as raw lung, liver and otherviscera (3, 6, 14). The milk of infected animals is a veryimportant source of infection, especially in rural areas,where milk is commercialized without pasteurization. Theevolution of the disease in cats is different from that inbovines, reaching earlier a generalization of the infectionthat leads to the death of the animal. The clinical signs ofthe disease are unspecific and affect several organs orfluids such as lymph nodes, intestines, kidneys, pleura,lungs, liver and/or brain. The confirmation of clinicalsuspicion must be carried out by culture from differentorgans or fluids (7). The National Plan of Control andErradication of Bovine Tuberculosis does not recommendthe use of the tuberculine test in dogs and cats becauseit can give negative false results (10). In Argentina, it ismandatory to report the cases of tuberculosis to sanitaryagents. Nevertheless, the information about the incidenceof bovine tuberculosis in cats in Argentina is incompleteand scarce (6, 11, 14). As an antecedent, 4% of the catsnecropsies at the School of Veterinary Sciences of the

216 Revista Argentina de Microbiologa (2009) 41: 215-217

University of Buenos Aires (UBA) presented tuberculosis(14).

The transmission of bovine tuberculosis can bestopped by implementing control programs, feeding petswith balanced food, pasteurizing milk, and cooking meatproducts.

However, in the last years in Argentina, these barriershave not been enough to protect pets from tuberculosis.People who adopt and rear many cats, together with theincrease of immunosuppressing diseases (felineimmunodeficiency virus and feline leukemia virus), haveled to an epidemiological change. Different molecularmethods are used to type the M. tuberculosis complex.One of them, called spoligotyping, is a PCR reverse lineblot hybridization method based on the polymorphism ofthe direct repeat (DR) region (8). This method is easy toperform and allows the differentiation of interspecies andintraspecies variability among the M. tuberculosis complex.However, although the method is not polymorphic enoughto identify close relationships, it can be useful for thedetermination of more distant relationships betweenisolates (15).

Therefore, in order to gain a deeper insight into tuber-culosis in cats, we have typed M. bovis isolates from catsfrom Buenos Aires city, Argentina, by spoligotyping.

MATERIALS AND METHODS

Stray cats from Buenos Aires city that had died by unknowncauses between 1998 and 2006 were submitted to the School ofVeterinary Sciences of the UBA to be necropsied. Nineteenisolates were obtained from the lymph nodes from all the animalsexcept for one, which was obtained from bronchoalveolar lavage(3) from a pet belonging to a woman that lived with 20 other catsin her house. These cats were fed daily with raw beef lung (3).Macerated lymph nodes and bronchoalveolar exudate sampleswere cultured in LowensteinJensen and Stonebrink media formycobacteria after decontamination by the Petroff method (4%sodium hydroxide) (5).

A loopfull of bacteria was suspended in 200l of distilled waterinto a 2-ml screw-cap tube and boiled for 30 min. After

centrifugation at 12,000 rpm for 5 min, 5 l of supernatant wasused for PCR (polymerase chain reaction) to performspoligotyping according to the protocol previously described byKamerbeek et al. (8), and using the spoligotyping kit (IsogenBiosolutions B.V., Ocimun Biosolutions Company, Ijsselstein, TheNetherlands). A cluster analysis of the spoligotype patterns wasperformed with the BioNumerics software (Windows NT, version2.5; Applied Maths, Kortrijk, Belgium). The categorical coefficientwas used to calculate the similarity of spoligotype patterns, andthe UPGMA (Unweighted pair-group method with arithmeticaverages) method was applied to calculate a dendrogram.Clusters of isolates were defined as two or more M. bovis strainswith identical spoligotypes. Each of the different spoligotypeswere allocated a number. M. tuberculosis H37Rv (ATCC 27294)and M. bovis Bacillus Calmette-Guerin (BCG) (ATCC 27289)were included as reference strains in each spoligotypingexperiment.

RESULTS

Nine different spoligotypes were detected among the19 M. bovis isolates from cats, eight of which were unique(Figure 1). All the strains lacked spacers 3, 9, 16 and 39to 43, characteristic of M. bovis isolates. There was onlyone cluster that grouped 11 of the isolates (57.9%) andshowed spoligotype Spo 34, identified as SB0140 in theinternational database of the University of Sussex, UnitedKingdom (UK) (http://www.mbovis.org/). This spoligotypeis the most frequent among the 542 M. bovis isolatesanalyzed from Argentina (15, 16), representing 46.9% ofthe total collection. The remaining eight spoligotypes hadonly one isolate each. Five of them (Spo 48, 70, 71, 75and 90) were exclusive of cats because neither bovinenor other host isolates from Argentina had been previouslydetected. The other three spoligotypes (Spo 3, 21 and29) had been found in bovine. In addition Spo 21 wasalso found in human, pig and armadillo isolates and Spo3 was also described in human isolates from Argentina.The spoligotypes not found in the University of Sussexdatabase were included to perform further comparisonsbetween laboratories.

Figure 1. Dendrogram showing the relationship between nine M. bovis spoligotypes detected among 19 cat isolates from BuenosAires city. The spoligotypes of reference strains of M. tuberculosis H37Rv and M. bovis BCG are also included. The numbers at thetop of the figure denote the spacers. Spo stands for spoligotype.

Spoligotyping of Mycobacterium bovis isolates from cats 217

DISCUSSION

Since cats are susceptible to the M. tuberculosis, M.bovis and M. avium complex, the isolates must be typedto adopt different health management programs. M. bovisis mainly transmitted to cats by the gastrointestinal routeafter the ingestion of contaminated food (6, 9, 14). It wasnot possible to know the infection source of the sampledcats, though they had probably been fed daily with rawbovine lung. Feeding stray cats in this way is an oldcustom of people from our country. This practice couldexplain the probable infection source of these cats.Moreover, the availability of contaminated bovine lungsin the city, suggests a failure in slaughterhouse inspection.The cluster that grouped 57.9% of the isolates from catsshowed the main spoligotype (Spo 34/SB0140) detectedin bovines from Argentina (15, 16). This spoligotype isalso predominant in the United Kingdom and othercountries that had imported cattle from the UK at the endof the nineteenth century (2). Spoligotypes Spo 3, 21and 29, were identified in a previous epidemiologicalstudy, grouped at 3.3, 20.1 and 2.8% of all the isolates(15, 16). Spo 21 is the second spoligotype in frequencyin Argentina and Spo 3 may be related to humans because61% of the isolates with this spoligotype were frompulmonary isolates from non-related humans (15, 16). Thepresence of these spoligotypes in M. bovis isolates fromcats, demonstrates the transmission from bovines to cats.

The distribution of the different patterns could be dueto epidemiological factors and the virulence of the strainwithin the population. In low prevalence areas, a highgenetic diversity is found in cattle populations, thusimplying a variety of unrelated ancestor strains (12).Intriguingly, there were five spoligotypes that were uniqueand exclusive of cats, not detected among the cattleisolates from Argentina, differentiated by one or fewspacers from those detected in bovines. These patternscould correspond to other genotypes from non-sampledbovines. On the other hand, the change of host could exertselective pressure on the mycobacterial genome, thusgiving new related patterns. Other authors have also foundspoligotypes from cats that were not found in isolates fromother animals, thus spoligotyping represents a good toolto detect new types from different host species (1).

Further studies will be necessary to confirm thepresence of M. bovis in bovine lungs from butchers stores.It is our belief that it is very important to be aware of therisk of the very old custom of feeding cats with raw bovinelung. Thus, we suggest that the best way to decrease theincidence of bovine tuberculosis in cats is feeding themwith balanced food pellets or well cooked food, reducingthe risk of human infections.

Acknowledgements: we thank H. Gil and R. V. Rocha (Ins-tituto de Biotecnologa, CICVyA-INTA, Castelar) and L.

Domnguez (Instituto Pasteur, Buenos Aires) for technicalassistance. This work was supported by grants from INTA. AC isa researcher from the National Research Council of Argentina(CONICET).

REFERENCES

1. Aranaz A, Libana E, Mateos A, Domnguez L, Vidal D,Domingo M, et al. Spacer oligonucleotide typing ofMycobacterium bovis strains from cattle and other animals:a tool for studying epidemiology of tuberculosis. J ClinMicrobiol 1996; 34: 2734-40.

2. Cataldi AA, Gioffr A, Santngelo MP, Alito A, Caimi K,Bigi F, et al. El genotipo de Mycobacterium bovis mayorita-rio en la Argentina lo es tambin en las Islas Britnicas: latuberculosis bovina provino de Gran Bretaa?. Rev ArgentMicrobiol 2002; 34: 1-6.

3. Colmegna I, Ricci BG, Zumrraga M, Cataldi AA, Di LonardoMM, Citera G, et al. Mycobacterium bovis and septicglenohumeral arthritis. Clin Rheumatol 2004; 23: 379-80.

4. Cousins DV, Bernardelli A, Bastida R, Cataldi A, Quse V,Dow S, et al. Tuberculosis in seals caused by a novelmember of the Mycobacterium tuberculosis complex:Mycobacterium pinnipedii sp. nov. Int J Syst Bacteriol 2003;53: 1305-14.

5. de Kantor IN. Bacteriologa de la tuberculosis. BoletnEpidemiolgico N11. Buenos Aires, CEPANZO OPS/OMS,1988, p. 26-35.

6. Fernndez F, Morici E. Tuberculosis felina porMycobacterium bovis: comunicacin de dos casos. RevArgent Microbiol 1999; 31 Supl 1: 19-20.

7. Jorge MC, Mendivil M, Fresneda K. Perros y gatos comohuspedes susceptibles y reservorios epidemiolgicos dela tuberculosis. XV Reunin Cientfico Tcnica de la Aso-ciacin Argentina de Veterinarios de Laboratorios de Diag-nstico, 2004, p. 167-8, Ciudad Autnoma de Buenos Ai-res, Argentina.

8. Kamerbeek J, Schouls L, Kolk A, van Agterveld M, vanSoolingen D, Kuijper S, et al. Simultaneous detection andstrain differentiation of Mycobacterium tuberculosis for diag-nosis and epidemiology. J Clin Microbiol 1997; 35: 907-14.

9. Kaneene JB, Bruning-Fann CS, Dunn J, Mullaney TP, BerryD, Massey JP, et al. Epidemiologic investigation ofMycobacterium bovis in a population of cats. Am J Vet Res2002; 63: 1507-11.

10. Kistermann JC, Torres PM. Epidemiologa de la tuberculo-sis bovina. In: Actualizacin de la tuberculosis bovina, Bue-nos Aires, SENASA, 1999, p. 37-46.

11. Martnez Vivot M, Ritacco V, Reniero A, Barboni A, GuidaN, Moras EV. Tuberculosis felina: caracterizacinbacteriolgica y genmica de los aislamientos en elConurbano bonaerense. In Vet 2001; 3: 179-82.

12. Michel AL, Hlokwe TM, Coetzee ML, Mar L, Connoway L,Rutten VP, et al. High Mycobacterium bovis genetic diversityin a low prevalence setting. Vet Microbiol 2008; 126: 151-9.

13. Torres P. Situacin de la tuberculosis bovina en la Repbli-ca Argentina. Buenos Aires, SENASA, 2006, p. 1-21.

14. Underwood S, Pinto MC, Rey Moreno JC, Carfagnini SC.Tuberculosis felina: casos diagnosticados y consideracio-nes sobre su posible fuente de infeccin. Rev ArgentMicrobiol 1999; 31 Supl 1: 17-8.

15. Zumrraga MJ. Epidemiologa molecular de la tuberculo-sis bovina. Tesis doctoral, FCEyN, UBA, 2007.

16. Zumrraga MJ, Martin C, Samper S, Alito A, Latini O, BigiF, et al. Usefulness of spoligotyping in molecular epidemiologyof Mycobacterium bovis-related infections in South America.J Clin Microbiol 1999; 37: 296-303.

Recibido: 26/05/09 Aceptado: 07/09/09

218 Revista Argentina de Microbiologa (2009) 41: 218-225ISSN 0325-7541Revista Argentina de Microbiologa (2009) 41: 218-225ARTCULO ORIGINAL

Echinococcus granulosus: biological comparison of cattleisolates from endemic regions of Argentina and Spain

M.V. ANDRESIUK*1,2, F. PONCE GORDO3, C. CUESTA BANDERA3, M. C. ELISSONDO1, 2,M. DOPCHIZ1, 2, G. DENEGRI1, 2

1Laboratorio de Zoonosis Parasitarias. Facultad de Ciencias Exactas y Naturales. Universidad Nacional de Mar del Plata. Funes3350 (7600) Mar del Plata, Buenos Aires, Argentina; 2Consejo Nacional de Investigaciones Cientficas y Tcnicas (CONICET),

Argentina; 3Departamento de Parasitologa, Facultad de Farmacia, Universidad Complutense de Madrid, Madrid, Espaa.*Correspondence. E-mail: mandres@mdp.edu.ar

ABSTRACTIn the present study we have compared cattle isolates of Echinococcus granulosus from Argentina and Spain. The aimwas to compare and determine if there exist phenotypic and genetic differences within E. granulosus cattle isolatesbetween an endemic area of Spain (where the disease is mainly restricted to a sheep-dog cycle) and an endemic areaof Argentina (where cattle are the most abundant intermediate hosts). The Spanish samples were previously identifiedas G1 genotype. The Argentinean samples were also identified as G1, but some variants were found for the cytochromec oxidase-1 (CO1) and NADH dehydrogenase-1 (ND1) mitochondrial genes. When comparing the cyst features andthe morphology of the larval rostellar hooks in both regions, some differences were found. The morphometric analysesof the larval rostellar hooks showed the existence of two distinct clearly separated groups (one corresponding to theArgentinean samples and the other to the Spanish ones). In conclusion, there are some genetic and phenotypicdifferences within E. granulosus cattle isolates from Argentina and Spain. Probably these differences, more importantfrom an epidemiological point of view, are related to different steps in the disease control in both countries. Furtherstudies involving other epidemiological, morphometric and molecular data, including other types of livestock, wouldcontribute to clarify and expand the present work.

Key words: Echinococcus granulosus, epidemiology, morphology, genotypes, Argentina, Spain

RESUMENEchinococcus granulosus: comparacin biolgica de aislados de bovinos de regiones endmicas de Argen-tina y Espaa. El objetivo del presente trabajo fue determinar si existen diferencias fenotpicas y genticas entre losaislados de Echinococcus granulosus de origen bovino provenientes de dos regiones geogrficas donde la hidatidosises endmica, una de Espaa (donde predomina el ciclo perro-oveja) y una de Argentina (donde el bovino es elhospedador intermediario ms importante). Las muestras espaolas fueron previamente identificadas comopertenecientes al genotipo G1. Las muestras argentinas tambin correspondan al genotipo G1, pero entre ellas seregistraron algunas microvariantes de los genes mitocondriales citocromo c oxidasa-1 (CO1) y NADH deshidrogenasa-1 (ND1). La comparacin de las caractersticas de los quistes y de la morfologa de los ganchos rostelares delmetacestode mostr ciertas diferencias. En conclusin, existen algunas diferencias genticas y fenotpicas entre losaislados de E. granulosus de Argentina y Espaa. Probablemente estas diferencias, ms importantes desde el puntode vista epidemiolgico, podran estar relacionadas con diferentes etapas en los programas de control de la enfermedaden los dos pases. Estudios adicionales que involucren datos epidemiolgicos, morfomtricos y moleculares provenientesde otros tipos de ganado contribuirn a clarificar y ampliar la informacin aportada por este trabajo.Palabras clave: Echinococcus granulosus, epidemiologa, morfologa, genotipos, Argentina, Espaa

INTRODUCTION

Echinococcosis-hydatidosis is a cosmopolitan zoono-sis caused by the cestode Echinococcus granulosus. Thisparasite shows great intraspecific variability in relation toits host specificity, epidemiology, morphology, biochem-istry, physiology and genetics (39). Various methodsbased on morphology, physiology, biochemistry and im-munology have been used to characterize the variants or

strains of E. granulosus (1, 2, 31, 39). These strains werelater identified as genotypes by molecular studies (G1 -G10) (7-9, 24, 35). Recently some authors have proposeda revision of the genus based on phylogenetic studiestending to re-categorize some genotypes to the specieslevel (27, 34, 41). Several studies around the world thathave been carried out to characterize the strains/geno-types of E. granulosus from a region or a country, havedemonstrated the existence of genetic variation or se-

Echinococcus granulosus from Argentina and Spain 219

quence heterogeneity in mitochondrial DNA within someof the recognized genotypes G1 - G10 (21, 22, 29, 33).Haag et al. (19) gave the name of haplotypes to themitochondrial sequences used to discriminate strains, andvariants, to the haplotypes with minor genetic differenceswithin a strain. Since then, different authors have de-scribed these mitochondrial variants or microvariantswithin E. granulosus (5, 6, 10, 32). Among the ten geno-types that have been described so far, the G1 genotypeis the most widespread around the world infecting sheep,cattle, pig, goat, buffalo and humans. In general, cattlehave been considered a poor suitable host for the G1genotype, although some recent studies have demon-strated that cattle could play a role as a reservoir of theG1 genotype in some areas like Algeria and Tunisia, whichis a serious risk for human health (4, 25, 40).

Although E. granulosus is widespread in the wholeterritory of Argentina and the hydatid disease is consid-ered endemic in this country, the infection does not havea homogeneous geographical distribution. The contribu-tion of each kind of livestock (cattle, pig, sheep, etc) inthe disease transmission depends on the region: for ex-ample while sheep is the principal host in the Patagonianand Mesopotamian region, cattle is the prevalent one inthe Pampa and northern regions of the country (14). Par-ticularly in the south-eastern region of Buenos Aires prov-ince (located within the Pampa region), hydatidosis - echi-nococcosis is considered an important human and vet-erinary health problem, being cattle the main livestockinvolved in the transmission of this disease. (3, 14, 15,16, 20)

In Spain, E. granulosus infects sheep, cattle, pig, goatand humans and several genotypes have been described.However, sheep is the main host involved in the trans-mission of the hydatid disease (11, 13, 18, 26, 30, 36).

The aim of the present study is to compare and deter-mine if there exist phenotypic and genetic differencesbetween E. granulosus isolates of cattle origin from anendemic central area of Spain (where the disease ismainly restricted to a sheep-dog cycle) and from an en-demic area of Argentina (southern region of Buenos Airesprovince) where cattle are the most abundant intermedi-ate hosts.

Material and methods

Origin and processing of samplesThe hydatid cysts were obtained from liver and lungs of

infected cattle. The Spanish samples were collected during theperiod 1990-1996 at slaughterhouses from the endemic centralregion of Spain (Autonomous Community of Madrid, Castilla -La Mancha, Castilla - Len, Extremadura, Aragn and Navarra).The Argentine samples were collected between 2003 and 2004at an abattoir located in the south-eastern region of Buenos Ai-res province. Each cyst was processed as an individual isolate.They were opened under sterile conditions, according to Smythand Davies (38). For each cyst, the external appearance andmacroscopical characteristics of the cyst wall, germinal

membrane and hydatid fluid (general aspect, color andtransparency, existence of calcified or degenerated areas andcontamination) were recorded. For the purposes of this study,the cysts considered viable were those having membranes whichdid not appear upset or degenerate, white, without calcified,caseous or degenerated regions, not contaminated and with atransparent hydatid fluid. Those cysts which had protoscoleceswere considered fertile. The vitality of protoscoleces (percentageof alive protoscoleces) was determined by their overall aspect(motility, flame cell activity, presence of calcareous corpuscles)and negative methylene blue staining. Viable and fertile cystswere further processed; germinal membranes were washed threetimes in sterile phosphate buffered saline (PBS) and stored at 4C (if to be processed within a short period of time) or at -20 Cuntil use. When hydatid sand was present, it was processedaccording to Smyth and Davies (38) and then stored in alcohol70-glycerine (1:1) at room temperature (for morphologicalstudies) or in alcohol 70 at 4 C or PBS at -20 C (for geneticanalyses).

Epidemiological dataThe number and location of cysts, their size, viability and

fertility were recorded for each geographical area under study.Comparisons between both regions were made using univariatetechniques for all the recorded variables (Fishers Exact Test,Mann Whitney and Students t test) (39). Statistical significancewas assessed at p 0.05. Mean intensity was calculated as themean number of cysts/infected animals (39).

Morphological studiesThe protoscoleces were processed according to Ponce Gor-

do and Cuesta Bandera (31). The number, shape and arrange-ment of rostellar hooks were recorded, and 5 variables wereused for statistical analysis: the total number of hooks perrostellum (NUM), the blade length of large (LBL) and small (SBL)hooks, and the total length of large (LTL) and small (STL) hooks.All measurements were made by the same people (M.V.A. andF.P.G. for the Argentinean samples and F.P.G. for the Spanishsamples). Comparisons between and within each region weremade by using univariate and multivariate techniques (PrincipalComponent Analyses) (31).

DNA analysis and sequencingThe identification of the Spanish isolates as belonging to the

sheep strain/G1 genotype had been previously carried out byusing biochemical and genetic analyses (13, 18, 26, 30, 36, 37).All the Spanish isolates presented 100% homology with thecytochrome c oxidase-1 (CO1) and NADH dehydrogenase-1(ND1) sequences of the G1 genotype originally described byBowles et al. (7) and Bowles and McManus (9) (GenBankAccession Numbers: M84661 and AJ237632).The genotype ofthe Argentinean isolates has been identified by using the samemitochondrial genes, following the same protocols and using thesame PCR conditions as previously described by other authors(7, 9, 26). The gene segment considered was 366bp in lengthfor CO1 (7) and 471bp in length for ND1 (9). The CO1 and ND1fragments were purified using the QIAquick PCR Purification Kit(Qiagen). Their sequences were obtained in an automatic DNAsequencer (ABI PRISM Model 377 Perkin Elmer) and comparedwith the ND1 and CO1 sequences of the G1-G10 genotypesavailable at the NCBI database (28).

RESULTS

Epidemiological analysisA total of 22 cattle were infected with E. granulosus in

Argentina and 94 in Spain. The mean intensity of infec-

220 Revista Argentina de Microbiologa (2009) 41: 218-225

tion for Argentinean cattle was 18.55 (408 cysts) and 5.61(527 cysts) for the Spanish ones. Whereas all Argentineancattle presented viable cysts, only 10.64% (10) of theSpanish cattle presented them. The percentage of cattlewith fertile cysts was clearly higher in Argentina (63.64%)than in Spain (6.38%). Percentage of cattle harboring vi-able and fertile cysts was significantly higher in Argen-tina (2 = 71.26, p < 0.00000 and 2 = 40.95, p < 0.00000respectively). Percentages of cattle with pulmonary orhepatic cysts were higher in Argentina (95.45% and 31.82)than in Spain (78.72% and 29.79%) but did not show sta-tistically significant differences between both regions (2= 3.36, p = 0.07 and 2 = 0.03, p = 0.85 respectively).Only 9.09% (2) of Argentinean cattle presented cysts inother locations. Almost all the cysts were located in theliver or lungs, being the latter the preferred organ in bothregions.

The total number of cysts, the number of viable andfertile cysts and the distribution of cysts by location areshown in Table 1. However, while the mean intensity ofliver infection was similar in Argentinean and Spanishcattle, the mean intensity of lung infection was about fourtimes higher in the Argentinean ones. The mean lung andliver intensity of viable and fertile cysts and the viable-to-total-cysts ratios were clearly higher in the Argentinean

samples; however the total fertile-to-viable-cysts ratio washigher in the Spanish samples, although no differenceswere found in this ratio when lung and liver cysts wereconsidered separately (Table 2).

The size and the external aspect of the cysts weresimilar in both regions. While most of the cysts rangedfrom 3 to 4 cm in diameter for both regions, there weresome up to 25 cm in diameter in the Argentinean sam-ples. In all cases, the color of the germinative membranewas whitish to yellowish and it was usually thin, with amucous aspect, and detached from the cyst wall. Thehydatid sand was whitish in fertile cysts with protoscolecesand brood capsules in the Argentinean and Spanish sam-ples. Few protoscoleces were present in the fertile Span-ish samples with a vitality percentage (alive/not aliveprotoscoleces) not higher than 80%, whereas a greatnumber of protoscoleces was present in the fertileArgentinean samples with a vitality percentage between80 and 100%.

Morphological studiesThe appearance of the larval rostellum in isolates from

Argentina and Spain was similar and consisted of 2 rowsof alternating large and small hooks. The comparisonsbetween the measurements of the different variables for

Table 1. Characteristics of the different kinds of hydatid cysts (total and per organ) in cattle from Ar-gentina and Spain. S.D.: standard deviation

Argentina Spain p value

Total cysts 408 527Lung % respect to total cysts 93.87 81.21

Results Mean intensity S.D. 17.41 24.65 4.55 4.23 0.00Per Liver % respect to total cysts 5.64 18.79Organ Mean intensity S.D. 1.05 2.15 1.05 2.28 0.88

Other % respect to total cysts 0.5 Locations Mean intensity S.D. 0.09 0.30

Total Viable cysts 189 13Mean intensity s.d. 8.59 16.22 0.14 0.45 0.00

Lung % respect to total cysts 41.67 1.13Results Mean intensity S.D. 7.73 16.16 0.06 0.28 0.00Per Liver % respect to total cysts 4.17 1.33Organ Mean intensity S.D. 0.77 1.85 0.07 0.34 0.00

Other % respect to total cysts 0.5 Locations Mean intensity S.D. 0.09 0.30

Total Fertile cysts 44 8Mean intensity s.d. 2.00 2.88 0.09 0.032 0.00

Lung % respect to total cysts 7.35 0.4Results Mean intensity S.D. 1.36 2.36 0.02 0.15 0.00Per Liver % respect to total cysts 3.2 1.14Organ Mean intensity S.D. 0.59 1.60 0.06 0.15 0.13

Other % respect to total cysts 0.25 Locations Mean intensity S.D. 0.05 0.21

Echinococcus granulosus from Argentina and Spain 221

each of the groups (Argentina and Spain) were statisti-cally analysed by the Students t test. All of them but one(LTL) presented significant statistical differences (Table3). Principal Components Analysis (PCA) was carried outwith data from 25 isolates of Argentinean cattle and the 8fertile isolates from Spain. Significant correlations werefound, indicating that an increase in the number of hookscorrelates with a longer blade in both the large and smallhooks and with a shorter total length of the small hooks.The criterion considered for the number of factors to beextracted was the greatest of the 75% variance rule andthe Scree test described by Cattell (12). Two factors were

finally extracted, which represented nearly 78% of thevariance. When isolates were plotted using both factors,two different groups became evident: one correspondingto the Argentinean isolates and the other to the Spanishones (Figure 1).

Genotype identificationAll Argentinean isolates (a total of 25) belonged to the

G1 genotype, but different variants of the G1 haplotypeoriginally described (GenBank accession no. M84661 andGenBank accession no. AJ237632) were identified for theCO1 and NADH1 mitochondrial genes in the present

Table 2. Ratios (total and per organ) of viable and fertile cysts in cattle from Argentina and Spain

Region StatisticalArgentina Spain significance

Viable to Total cyst ratioTotal 0.46 (189/408) 0.02 (13/527) 0.00Per Lung 0.44 (170/383) 0.01 (6/428) 0.00Organ Liver 0.74 (17/23) 0.07 (7/99) 0.00

Other locations 1 (2/2) 0 Fertile-to-total cyst ratioTotal 0.11 (44/408) 0.01 (8/527) 0.00Per Lung 0.08 (30/383) 0.01 (2/428) 0.00Organ Liver 0.56 (13/23) 0.06 (6/99) 0.00

Other locations 0.50 (1/2) 0 Fertile-to-viable cyst ratioTotal 0.23 (44/189) 0.62 (8/13) 0.00Per Lung 0.17 (30/170) 0.33 (2/6) 0.33Organ Liver 0.76 (13/17) 0.86 (6/7) 0.61

Other locations 0.50 (1/2) 0

The data in parenthesis indicate the number of cysts used in the calculus.

Table 3. Rostellar-hook measurements of the protoscoleces of E. granulosus from hydatid cysts of cattle origin from Argenti-na and Spain. S.D: standard deviation

Morphometric VariablesN of LBL LTL SBL STL NUM

samples Average Average Average Average Average S.D. S.D. S.D. S.D. S.D.

(Maximum- (Maximum- (Maximum- (Maximum- (Maximum--minimal) -minimal) -minimal) -minimal) -minimal)

Argentina 24 13.52 0.37 24.72 0.53 9.27 0.3 20.10 0.30 37.61 0.79(12.9 -14.4) (24.0 - 26.2) (8.6 - 9.9) (19.4 - 20.8) (33 - 48)

Spain 8 12.85 0.19 24.51 0.15 9 0.23 21.06 0.19 34.25 1.16(12.6 -13.1) (24.2 - 24.7) (8.8 - 9.4) (20.8 - 21.4) (32 - 36)

Students t test t=4.876 t=1.164 t=2.349 t=8.444 t=9.220statistical significance p=0.00 p=0.25 p=0.03 p=0.00 p=0.00

LBL, blade length of large hooks; LTL, total length of large hooks; SBL, blade length of small hooks; LTL, total length of small hooks; NUM, number ofhooks per rostellum. Lengths in micrometers.

222 Revista Argentina de Microbiologa (2009) 41: 218-225

study. While some sequences were identical to the origi-nal one described for the CO1 gene (GenBank acces-sion no. M84661), there were two other different variantsin the CO1 sequence with transition mutations: one vari-ant with a mutation at position 73 (CxT) (GenBank acces-sion no. AF458871) and the other one with a mutation atposition 111 (TxC) (GenBank accession no. AF458875).For the NADH1 gene only one sample was identical tothe original one (GenBank accession no. AJ237632) and3 other different variants were registered in the rest of thesequences: one of the variable sequences showed a tran-sition mutation at position 282 (TxC) (GenBank acces-sion no. AF297617), another one showed mutations at 2different positions: 282 = TxC and 342 = CxT (NADH1_a)and the last one at 3 different positions: 27 = TxC; 181 =TxC and 282 = TxC (NADH1_b).

DISCUSSION

The present work is the first to compare and deter-mine if there are differences in phenotypic and molecularfeatures in E. granulosus cattle isolates from endemicareas in Argentina and Spain, where the abundance ofthis intermediate host as well as the i